Cabinet of Ministers Regulations No. 146, Riga, 14 March 2017 (pr. No 12 24. §) rules on the veterinary requirements of the aquaculture animals, their products and their movement, as well as the aquaculture animal diseases prevention and combat Issued in accordance with article 25 of the law on veterinary medicine 1 and paragraph 10 i. General questions 1. establishes the health requirements in aquaculture animals and products derived therefrom, as well as the movement of aquaculture animals for infectious disease prevention and control. 2. The terms used in the following terms: 2.1. aquaculture: the rearing or cultivation of aquatic, using techniques designed to increase the production beyond the natural capacity of the environment where these animals breeding or growing up to the time of collection (including) one or more natural or legal persons; 2.2. Sentinel animals in aquaculture-aquaculture animals used in aquaculture animal diseases diagnosis during quarantine; 2.3. aquaculture production business-institutional entity, in which takes place with the rearing of aquaculture animals, breeding or farming activities; 2.4. the aquaculture production business operator: the natural or legal person responsible for the requirements of these rules, observance of their control aquaculture establishment; 2.5. the authorised processing establishment operator: the natural or legal person responsible for the requirements of these rules, observance of recognised processing plant; 2.6. recognized recycling company, a food company, which the European Parliament and of the Council of 29 April 2004, Regulation (EC) No 853/2004 laying down specific hygiene rules for food of animal origin (Regulation (EC) No 853/2004) article 4 recognized the processing of aquaculture animals, and assigned an approval number; 2.7. the farm-aquaculture production business, in a fenced area on the territory of the company or plant in which aquaculture animals are reared to be offered on the market, excluding space, fenced area or facility where wild aquatic animals harvested or noķerto there not fed until their slaughter and food; 2.8. farm fishing-pond or other installed reservoir where the animal population is maintained for recreational fishing, restoring items with aquaculture animals; 2.9. farming – rearing of aquaculture animals in a farm or in a bivalve mollusc farming area; 2.10. growing area – freshwater, sea, estuarine, continental or lagoon area containing natural beds of bivalve molluscs or sites in the bottom, the bivalve molluscs used for cultivation, from which bivalve molluscs obtained; 2.11. the buffer-zone around the infected farms or fish bivalve mollusc farming area, in which implementation of disease control measures to prevent spread of the disease; 2.12. aquatic animals, aquatic animal figured that there is grown or marketed for decorative purposes; 2.13. the bivalve shellfish growing area, production or relaying area in which all aquaculture production businesses operate under a common biosecurity system; 2.14. the natural waters of the European Union, the Member States of the European Union within an existing developed naturally (without human assistance) watercourses (rivers, streams, channels or portions of them), bodies of water (Lakes, ponds, water reservoirs, or portions of them), as well as transitional waters or coastal waters-stage; 2.15. the epizootiological unit – a group of aquatic animals in a particular territory endangers one agent. Hazards may result joint water environment or management practices that enable one group of animals of the pathogen to quickly move on to another group of animals; 2.16.-an epizootiological unit compartment-one or more farms or mollusc farming areas, covered a common biosecurity system and existing aquatic animals have specific health status with respect to a specific disease incidence or the aquatic animal health situation in relation to the specific infectious agent depends on the State of health in relation to these infectious disease agents surrounding natural waters; 2.17. infection – the disease agent in the presence of the vector species, which breed in or otherwise developing, or is the latent condition; 2.18. the infected zone, infected station-zone or compartment, which established the infectious disease; 2.19. the new disease, recently found, the cause of which may or may not be defined and which can spread in the population, and between the populations (such as 800s with aquatic animals or animal products). It is also already known disease that identified the new species, which in the vector is not included in annex 1 of these rules as a susceptible species; 2.20. the quarantine-keeping a group of aquatic animals in isolation, preventing any direct or indirect contact with other aquatic animals. Insulation to determine time period this group observed, perform the analysis, processing and waste water treatment; 2.21. the quarantine facility, enclosed spaces, the complex or the area provide the quarantine of aquaculture animals. Quarantine of one or more of the quarantine unit, and it is registered with the European Parliament and of the Council of 29 April 2004, Regulation (EC) No 882/2004 on official controls performed to ensure the verification of compliance with feed and food law, animal health and animal welfare rules (hereinafter referred to as Regulation (EC) No 882/2004), article 2, paragraph 4, according to the meaning of that provision and paragraph 129.130 of these requirements. 2.22. unit-operation of quarantine and space designated quarantine station part of the consignments of aquaculture animals, with the same health and aquaculture Sentinel animals, if necessary; 2.23. continental farms, aquaculture farm, animals in which aquatic animals there and located in a Member State of the European Union in the Mainland in the territory, which include: 2.23.1. the entire catchment area from the sources of the sources to the estuary or more than one catchment area in which fish is reared, kept or caught, and which may include a buffer zone; 2.23.2. the part of a catchment area from the sources of the waterways to a natural or artificial barrier preventing fish migrating from the watercourse downstream of the dam and part of which can cover a buffer zone; 2.24. the continental zone – an area in which one or more Member States of the European Union on the Mainland geographically accurate in areas with homogeneous hydrological system that covers a catchment area from the source to the parts of a natural or artificial barrier that prevents the upward migration of aquaculture animals from the lower catchment area, or all of the stages of the water catchment area from the source to the mouth, or a number of catchment areas with their mouths (in the mouth produces an epizootiological links between catchment areas); 2.25. continental station-station with one or more farms, which are located in one or more Member States of the European Union on the Mainland, which has developed a common biosecurity system, which is the aquaculture animal population to determine the State of health in relation to specific disease; 2.26. commercial size-aquaculture animals weight and body size, which is rational to kill, for processing aquaculture animals for food products; 2.27. common biosecurity system – the system, which applies the same animal health surveillance, disease prevention and disease control measures; 2.28. mortality-death of aquatic animals, if the total death rate significantly exceeds the levels in certain circumstances be considered normal or bivalve molluscs farm growing zone. What is mortality, decides the growers with food and veterinary service (hereinafter service) officers; 2.29. does not use – disease control, during which the farm is released from the water, which meets in the aquaculture animals, or the release of aquaculture animals susceptible to the particular disease agent or potential to carry this disease agent; 2.30. the officially declared infected the farm – the farm aquaculture animals, which the service has been approved by one or more of these provisions in part II of annex 1 of aquaculture animals not referred to an exotic infectious disease; 2.31. the offering on the market – sale, offer to sell, or any other form of transfer, whether free or not, as well as any movement of aquaculture animals which provides that property rights; 2.32 contact existing nursery-nursery in which aquaculture animals are kept, which in any way is proven or suspected of being infected with infectious (contaminated) material from the officially declared infected farms; 2.33. wild aquatic animals – Fish for aquatic animals belonging to Chondrichthy and Osteichthy classes, Phyla of Mollusca, fish bivalve molluscs, subphylum crustacea that live in the wild and there is no aquaculture animals; 2.34. the disease – aquatic animal infection with one or more agents, which are conducted with or without clinical signs; 2.35. disease-free zone or compartment, zone or compartment that is declared by the authorities on the disease; 2.36. vectors – animal species that is not susceptible to a disease agent, but the ability to spread the infection, the transfer of pathogens from one species to another; 2.37 transport medium – medium with cell culture, which is 10% calf serum and 200 IU penicillin, 200 μg Streptomycin and kanamycin per 200 mg per ml of culture medium or other antibiotics with proven efficacy; 2.38. the traditional extensive lagoon aquaculture practice – a mollusc in shallow sea, estuarine or lagoon Bay, by the sea or ocean separates sand and boundaries clearly marked and indicated by buoys, posts or any other fixed means, if this area is used exclusively for the natural purification of live molluscs; 2.39. further processing – the processing of aquaculture animals before human consumption, by using techniques and technologies affecting anatomical wholeness (such as bleeding, gutting, head cut, slicing, filleting) that produce waste or by-products which could cause a risk of spreading disease; 2.40. the species susceptible-animal species, infection with infectious disease agent has found a natural way or is proven experimentally, render natural contamination routes; 2.41. the aquatic animals, Fish, belonging and Osteichthy class Chondrichthy fish, bivalve molluscs Phyla of Mollusca, subphylum crustacea; 2.42. the health certification (evaluation)-service activities in order to assess the health status of aquaculture animals according to the requirements of the rules and determine the risk of spreading infectious diseases. Health certification (evaluation) is probably the movement of aquaculture animals which do not arise in the infectious disease transmission to other farms in the territory of Latvia in the zone or compartment or to another territory of the Member States of the European Union; the area of 2.43., the exact geographical area with a homogeneous hydrological system, consisting of the catchment area is part of its source to natural or artificial barrier that prevents the upward migration of aquatic animals from lower in the catchment area of the stage, or the entire catchment area from the source to the mouth, or a number of catchment area, including their inlets, if they relate to an epizootiological catchment area. 3. the rules do not apply to: 3.1 ornamental aquatic animals reared in aquariums not commercial purposes; 3.2. wild aquatic animals which are caught or collected for use in the food chain; 3.3. the aquatic animals to catch their fish flour, fish feed, fish oil and similar products. 4. These rules 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14, paragraph (iii), (IV) and chapter XIII shall not apply to ornamental aquatic animals that commercial purposes are there, garden centres, garden ponds, aquariums or wholesalers, providing the there to: 4.1 aquatic animals do not come into contact with the natural waters of the European Union; 4.2. waste water treatment plant, installed in aquatic animal holding areas, minimise the risk of infectious disease in natural waters of the European Union. 5. Rules for the supervision and control of service carried out in accordance with Regulation (EC) no article 882/2004 3. Monitoring and control includes regular inspections, visits, audits and, where necessary, sampling each aquaculture production business, taking into account the risks that can arise through aquaculture animals with infectious diseases. Service monitoring and control is done in Chapter XV of these provisions and in annex 2. II. Aquaculture production businesses and processing establishments aquaculture on registration procedures for the recognition of and the order in which business operators provide service in the required information, 6. Natural or legal persons shall submit the application to the service: to register: 6.1 6.1.1. facilities and equipment that is not recognised on aquaculture production businesses, where aquatic animals are kept without the intention to offer them on the market (this requirement does not apply to private property in aquariums); 6.1.2. aquaculture production businesses that offer on the market of aquaculture animals for human consumption in accordance with Regulation (EC) No 853/2004 1. paragraph 3 of article "c" section; 6.2. for the recognition of: 6.2.1. aquaculture industry companies individually; 6.2.2. aquaculture production businesses in the Group; 6.2.3. processing plant. 7. by paragraph 6 of these regulations in due receipt of the application referred to in service: 7.1. assign a registration number in point 6.1 of these regulations the following companies, shall draw up a list of companies registered and places this information in the tīmekļvietn; 7.2. evaluate this rule 6.2. companies referred to under point 8 of these rules. If a positive decision has been taken, the approval number assigned, shall draw up a list of establishments recognised and puts this information in the tīmekļvietn. 8. Service number of recognition granted such aquaculture industry or processing establishments: 8.1 is created and implemented a series of measures to ensure that the requirements of these regulations; 8.2. is the supervision; 8.3. to fulfil these rules 15, 16, 17, 18, 19, 20 and 21 above; 8.4. the aquaculture animals kept or bred. If the aquaculture production business is recognised as a new company, the aquaculture production business operator shall produce a contract for the delivery of aquaculture animals, or equivalent information, proving that the aquaculture production business in the future will deal with the rearing of aquaculture animals, or possession; 8.5. in the processing of aquaculture animals. 9. the service shall take the aquaculture production business and individual recognition award of recognition. Several aquaculture production businesses, where they obtained the bivalve molluscs and aquaculture industry, if these companies are located in one of the bivalve mollusc farming area may recognize the group. The group recognised a number of aquaculture sector companies assign an approval number. Bivalve molluscs to dispatch centres, purification centres and similar businesses in the aquaculture industry recognised individual. 10. Service recognition of individual refineries and give approval number, if the processing undertaking engaged in the slaughtering of aquaculture animals in order to control the spread of the disease. 11. the establishment of the aquaculture industry or processing establishment shall not be recognised and an approval number shall be granted if the company may result in an unacceptable risk of the spread of infectious diseases to other farms, the bivalve mollusc farming areas or this company in nearby wild aquatic animal resources. Officers before a decision on the recognition process and the approval number of the exclusions, taking into account the epizootiological situation in the aquaculture production business or processing plant, determine the risk mitigation measures, as well as the Organization of relevant activities in other places. Officers of the approval number shall be granted if the aquaculture production business or processing establishment operator takes all the risk of spreading infectious disease mitigation measures. 12. Aquaculture production business operator shall provide services and service for the tīmekļvietn enter the following publicly available information: 12.1. aquaculture production the company name, address, and contact information (phone, fax number and e-mail address); 12.2. aquaculture production business registration number or approval number; 12.3. the aquaculture industry (nursery), the geographical position (use a suitable coordinate system for all farms (GIS coordinates)); 12.4. aquaculture production business (farms) and the type of production (cultural systems or machine type), maximum production, if it is moderated; 12.5. for the farm water supply and exhaust-continental farms, as well as the dispatch and purification centres; 12.6. aquaculture production business (farm) aquaculture animals species grown. Nursery grown several species of aquaculture animals, or nursery of ornamental aquatic animals indicates if any of these species are susceptible to these rules referred to in annex 1. infectious diseases or is this vector; 12.7. If the bivalve mollusc farming area in recognition of the number assigned to a group, this rule 12.1, 12.2, 12.3., 12.4, 12.5 and 12.6. submit the information referred to in point of all aquaculture production businesses that operates in one of the bivalve molluscs in the production area. 13. the service shall enter in tīmekļvietn the following publicly available information on aquaculture production business: 13.1 the animal health situation for aquaculture animals (such as the farm is infectious disease). Information entered in a period of two weeks after service of the checks carried out; 13.2. or farms introduced infectious disease control programme to achieve the infectious disease-free status of the farm. Enter information in the two weeks after the start of the implementation of the programme; 13.3. or a farm is declared to be infected with any of the rules referred to in annex 1 of infectious diseases. Information is entered immediately after the pronouncement of the infected farms. 14. the processing establishment operator submit service and enter tīmekļvietn in the service of the following publicly available information: 14.1. recycling the company name, address, and contact information (phone, fax number and e-mail address); 14.2. the processing establishment registration number or approval number; 14.3. processing the company's geographical position (use a suitable coordinate system (GIS coordinates)); 14.4. processing plant wastewater treatment system (water treatment, waste water treatment system construction, laboratory studies on the exhaust effluent quality, tails (if any) the disposal site); 14.5. the refinery processed aquaculture animal species. III. the aquaculture production business operator, processing plant operator and carrier responsibilities 15. Aquaculture production business operator shall make such records: 15.1. all types of aquaculture animals and products thereof on the farm or by the movement of bivalve mollusc farming area and; 15.2. the mortality rate in each unit according to the epizootiological type of production; 15.3. aquaculture animal health surveillance results obtained in accordance with the provisions of paragraphs 20 and 21. 16. the authorised processing establishment operator shall keep records of all aquaculture animals and their products to the enterprise and the motion of it. 17. Transport of aquaculture animals, the carrier shall take the following records: 17.1. aquaculture animal mortality during transport, according to the mode of transport and the species of animal to be transported; 17.2. the aquaculture animals during transport visited farms, the bivalve molluscs farming areas and processing plants; 17.3. the water inlets and water discharge locations, as well as the transport of water replacement. 18. Aquaculture production business operator 15.1 these rules referred to registration is carried out by providing the origin and traceability of the place of destination. 19. the aquaculture production business operator and the processing establishment operator company following the observance of the laws in the area of hygiene to prevent infection and spread of diseases. 20. All farms and bivalve molluscs farming areas of the aquaculture production business operator contracts with practising veterinarians to create and implement the aquaculture animal health surveillance scheme according to annex 2 of these rules. 21. The rules referred to in paragraph 20 of the aquaculture animal health surveillance scheme designed to detect: 21.1. mortality of bivalve molluscs in all farms and farming areas according to the type of production; 21.2. the rules referred to in annex 1 of infectious diseases, as well as against the susceptible aquaculture animal species. IV. Health requirements for aquaculture animals and products derived from them offering the market 22. the requirements set out in this chapter apply to the rules referred to in annex 1. infectious diseases and the susceptible aquaculture animal species. Of aquaculture animals, the owner or keeper shall ensure that aquaculture animals and products thereof on the market do not jeopardise the health status of aquatic animals with regard to the rules referred to in annex 1 of aquaculture animal infectious diseases (to prevent spread of infectious animal diseases of aquatic animal populations). 23. the aquaculture animals and their products which do not comply with the requirements of this chapter, be allowed to be marketed for use for scientific purposes (research, tests and other similar activities, to do research, not related to live aquaculture animals and their food collection and distribution of the food chain). The service performs the following periodic control of animals, so they observed, or aquaculture animals do not cause enhanced infectious disease spreading in the territory of destination or transit points. 24. The provisions referred to in paragraph 23 the aquaculture animals shall be distributed in the Member States of the European Union, if the competent authorities of the Member States involved in the control of infectious diseases of aquaculture animals, have been informed of such transport of aquaculture animals and trade with them. 25. the aquaculture animals during transport: 25.1. infectious disease prevention measures to changed during transport carried the animal health situation for aquaculture animals and reduce the spread of communicable diseases; 25.2. ensure conditions that do not threaten the territory of destination and transit points of aquaculture animals living health status; 25.3. water replacement shall be carried out in places and conditions which do not endanger persons health status of aquaculture animals, the health status of aquatic animals at the place of water replacement and the health status of aquatic animals at the place of destination. Water replacement in place, the following requirements shall be met: 25.3.1. water is subjected to a treatment, which destroys the causative agents of infectious diseases, and after going into the water in the environment is not affected in the aquatic animal health status; 25.3.2. replaceable water not containing infectious agents that can infect animals being transported to aquaculture animals and animals in the territory of destination. 26. the aquaculture animals of the owner or keeper shall ensure that aquaculture animals going into the market of Latvia (the Latvian entry in the territory of the country, zone or compartment that is declared free of infectious diseases or subject to infectious disease surveillance or eradication programme), which is the appropriate health status of aquaculture animals (the European Union Member State competent authority has taken the health certification (evaluation) and are issued by a veterinary health certificate if they are recognized as valid for further distribution without the risk of spreading infectious agents), if these animals are used in any of the following objectives: 26.1. farming or restocking; 26.2. for further processing before human consumption (excluding slaughtered and from internal organs released (gutted) fish or bivalve molluscs and crustaceans, which are sent as raw or processed products). 27. the aquaculture animal health certification (evaluation) carried out before placing on the market of aquaculture animals, where are these rules 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, and laid down in point 68. control and eradication measures in the subject area. If the aquaculture animal health certification (evaluation) process has taken a positive decision, Department of aquaculture animals shall be issued by the veterinary health certificate that you have permission to distribute the aquaculture animals outside this rule VII, VIII and IX chapter in disease control and eradication measures zones to other Member States of the European Union. 28. the service for the movement of aquaculture animals notified to the computerised system (European Union of the electronic information exchange System), if: the transport of necessary 28.1. veterinary health certificate and aquaculture animals are moved from the territory of the Republic of Latvia to the other Member States of the European Union; 28.2. the transport does not require a veterinary health certificate and of live aquaculture animals are transported from the territory of the Republic of Latvia to the other Member States of the European Union for farming or restocking. 29. the aquaculture animals of the owner or keeper shall ensure that aquaculture animals on the market to offer production: 29.1. would be clinically healthy; 29.2. not from a farm or mollusc farming area of the bivalve, which found unresolved increased mortality, except if you have an infectious disease spreading risk assessment and aquaculture animals are from a farm or bivalve molluscs in part of the farming area that is independent of the epizootiological unit where the increased mortality. 30. it is not allowed to offer on the market for farming or restocking aquaculture animals which aquaculture production business in which aquaculture animals found infectious disease outbreak or suspected infectious disease presence. 31. the aquaculture animals of the owner or keeper shall ensure that aquaculture animals offers the wild for restocking and fishing farms: 31.1. it would be clinically healthy; 31.2. should not from a farm or mollusc farming area of the bivalve, which found unresolved increased mortality, except in the case of infectious diseases spreading risk assessment and aquaculture animals are from a farm or bivalve molluscs in part of the farming area that is independent of the epizootiological unit where the increased mortality; 31. it would be from a farm or mollusc farming area of the bivalve, which condition is equivalent to the waters of the health situation of aquaculture animals which skips, or aquaculture animals should be obtained in the zone or compartment, in accordance with the provisions of chapters XIII and XIV of the requirements has been declared free of communicable diseases. 32. to the Latvian territory, zone or compartment that is declared to be a specific infectious disease-free zone or compartment (comply with the provisions of chapters XIII and XIV mentioned requirements) would be susceptible to the import of aquaculture animals for farming or restocking, the place of origin of aquaculture animals shall be such Member State of the European Union, or district, which has been declared a particular infectious disease. 33. The provision in paragraph 32 that condition does not apply if the scientific evidence that a particular infectious disease agent susceptible aquaculture animal species in certain stages of development of this disease do not. 34. the service shall take control of aquaculture animal species other than those referred to in annex 1 of these regulations, where, according to scientific studies or practical experience in data confirms that the species aquaculture animals may carry over some of the rules referred to in annex 1. infectious diseases. 35. The provision referred to in paragraph 34. aquaculture animals are allowed to be imported for breeding or restocking of the zone or compartment that is declared to be a specific infectious disease, if one of the following conditions is fulfilled: 21.8. vectors of infectious diseases of animals species originating in a Member State of the European Union, zone or compartment declared free of a specific infectious disease; 35.2. infectious disease vectors in animal species kept in quarantine facilities or water, to avoid the risk of infectious disease transmission. Infectious disease vectors in animal species kept in water, which is not present in a particular infectious agent. The quarantine period must not be less than two weeks. 36. Aquaculture animals which are susceptible to any of these provisions annex 1 referred to in part II of the non-exotic diseases in aquaculture animals and products allowed on the market for further processing in the territory of the Latvian State, zone or compartment declared free of a specific infectious disease if those aquaculture animals and their products meet one of the following conditions: 36.1. aquaculture animals originating in a Member State of the European Union , zone or compartment declared free of a specific infectious disease; 36.2. the aquaculture animal products are processed in an authorised processing establishment in hygienically clean conditions according to the law on food hygiene requirements and prevent the spread of infectious diseases; 36.3. the fish before sending it is slaughtered and eviscerated; 36.4. the bivalve molluscs and crustaceans from their places of origin or primary are sent as unprocessed or processed products. 37. Live aquaculture animals which are susceptible to any of these provisions annex 1 referred to in part II of the non-exotic diseases, the market for further processing in the Latvian territory, zone or compartment declared free of a specific infectious disease, if it is stored in a processing site for no longer than seven days and one of the following conditions is fulfilled: 37.1. aquaculture animals originating in a Member State of the European Union , zone or compartment that is declared to be a specific infectious disease; 37.2. the aquaculture animals for no longer than one month there, dispatch centre or purification centre, equipped with an effluent treatment system, which is capable of inactivating certain pathogens or where the effluent is subject to processing, which reduces the risk of transmitting diseases to the natural water bodies. 38. The aquaculture animals susceptible to the rules referred to in annex 1 of the contagious diseases of aquaculture animals and products that are offered on the market for human consumption without further processing, packaged retail packages which comply with Regulation (EC) No 853/2004 the rules on packaging and labelling. 39. Live bivalve molluscs and crustaceans, which are susceptible to any of the provisions listed in annex 1. infectious diseases allowed to skip the European Union imports of aquaculture farms, dispatch centres, purification centres or similar businesses, if molluscs and shellfish store processing site for no longer than seven days and one of the following conditions is fulfilled: 24.3. aquaculture animals originating in a Member State of the European Union, zone or compartment that is declared to be a specific infectious disease; 24.4. aquaculture animals for no longer than one month there, dispatch centre or purification centre, equipped with an effluent treatment system capable of inactivating that specific pathogens or where the effluent is subject to other types of treatment reduces to an acceptable level the risk of transmitting diseases to the natural water bodies. 40. Wild aquatic animals that are susceptible to any of the provisions listed in annex 1 of infectious diseases if they are trapped in the Latvian territory, zone or compartment not declared certain infectious disease, officers under the supervision of quarantines to reduce the risk of transmission of infectious diseases. After the end of the quarantine period of aquatic bivalve molluscs in farms or skip farming area situated in the territory of the Latvian State, zone or compartment declared free of the infection. 41. The traditional extensive lagoon aquaculture practice allowed without this provision referred to in paragraph 40 the insertion, if a risk assessment is carried out and found that the occurrence of infection is not greater than that which would arise when applying this provision of paragraph 40. 42. Ornamental aquatic animals allowed on the market if they do not endanger the health of aquatic animals with regard to contamination with other contagious diseases not referred to in these rules, and these rules are not prevalent 1. infectious diseases listed in the annex. V. aquaculture animals and their products from countries which are not Member States of the European Union 43. aquaculture animals and products thereof imported into Latvia from countries which are not Member States of the European Union (hereinafter third countries), or parts thereof, if its included in the European Commission and published in the list. 44. All aquaculture animals and their products from third countries or parts thereof is accompanied by a veterinary health certificate which certifies that the consignment complies with those rules: 44.1.; 44.2. the requirements laid down in other regulations for the protection of public and animal health. Vi. Notification of infectious diseases and aquatic animals in aquaculture animals and infectious disease control measures 45. Information about the disease of aquaculture animals with these rules referred to in annex 1. infectious diseases or suspicion of the presence of these diseases (including diseases of aquaculture animals, the mortality) aquaculture the owner or keeper of the animals, the owner of the processing plant, a practicing veterinarian, laboratory Manager of an authorised person or any other person who has contact with the aquaculture or aquatic animals (the person that takes care of the aquaculture animals or spend them during transport), given in accordance with the laws and regulations on the reporting, and public supervision register existing infectious animal diseases and the order in which information about them. 46. the service within 24 hours of receiving the information that confirmed fears about infectious disease, shall inform the European Commission, the other Member States of the European Union and the European Free Trade Association Member States, stating: this provision concerned 46.1. of annex 1, part I, exotic infectious diseases; 46.2. the relevant provisions of this annex 1, part II of the non-exotic diseases, if the Latvian country, zone, or compartment has been declared to be a specific infectious disease area, zone or compartment. 47. Where there is a suspicion of any of the rules referred to in annex 1 of the communicable diseases in the territory of Latvia, a zone or compartment where the animal health situation for aquaculture animals for disease corresponds to the provisions laid down in annex I or III category: 29.3. officers shall take samples and send them to the reference laboratory; 47.2. the officer to receive the results of analyses of bivalve molluscs in farms or farming area shall monitor and carry out control measures to prevent the spread of other infectious diseases of aquatic animals or of aquaculture animals; 47.3. to receive the results of analyses in the affected farm or mollusc farming area of bivalve banned the import of or export from the aquaculture animals, except when the officers has given written permission to send the animals to a recognised aquaculture processing plants engaged in the slaughtering of aquaculture animals in order to control the spread of the disease; 47.4. the officers shall carry out an epizootiological enquiry in accordance with this provision and paragraph 48.49. 48. the Epizootiological inquiry shall be carried out in the laboratory studies, if found sick with any of the provisions listed in annex 1:29.9. exotic infectious diseases Latvian territory, zone or compartment; 48.2. the non-exotic diseases in the territory of Latvia, a zone or compartment where the animal health situation for aquaculture animals for infectious disease found to meet these rules laid down in annex I or III category. 49. the Epizootiological inquiry shall be carried out to: 30.5. identify the potential sources of infectious disease and vector factors; 30.6. check whether aquaculture animals have left the farm or bivalve mollusc farming area during the relevant period preceding the notification of suspicion of contamination; 30.6. the exploration, or other non-infected farms or bivalve mollusc farming area. 50. If this provision in paragraph 49 that an epizootiological investigation found that the infection may have spread to one or more farms, the bivalve mollusc farming areas or open water, the said locations shall: 50.1. officers shall take samples and send them to the reference laboratory; 50.2. until receiving the results of the officers asks the owner of aquaculture animals or to the holder to take restrictive measures to prevent the spread of other infectious diseases of aquatic animals or of aquaculture animals, and control their execution; 50.3. until receiving the results of analyses in the affected farm or mollusc farming area of bivalve banned the import of or export from the aquaculture animals, except when the officers has given written permission to send the animals to a recognised aquaculture aquaculture processing company that deals with aquaculture animals slaughtered to control the spread of the disease. 51. If the infectious disease area is an extensive water catchment areas or coastal areas, the service that rule 50. measures referred to in paragraph 1 shall be limited to a smaller area that is suspected of being infected farms or molluscs bivalve farming area in the immediate vicinity which is large enough to warrant the limitation of infectious diseases. 52. the service within three working days from the date of the suspected contamination of aquaculture animals, by any of the rules referred to in annex 1. infectious diseases, shall inform the competent authorities carrying out the infectious animal disease control and supervisory functions of the neighbouring Member States of the European Union and in third countries. 53. the service removes this rule 47.2, 47.3 and 47.4.. referred to restrictive measures, if in the laboratory studies are found sick with one of infectious diseases. VII. Monitoring and control measures after the exotic infectious diseases of aquaculture animals, finding 54. Then of aquaculture animal infection with exotic and infectious diseases reference laboratory confirmed the diagnosis: 54.1. the service of bivalve shellfish farm or growing zone determines the restrictions referred to in this chapter and declare it to be infected; 54.2. the service around the infected farm or mollusc farming area of bivalve establishes buffer zone in which the protection zone and the surveillance zone (zone size is determined according to the spread of infectious diseases); 54.3. bivalve molluscs in farms or farming area stopped restocking, but without the introduction of aquaculture animals in the buffer zone; 54.4. aquaculture animals shall not be moved within the buffer zone and not leave them, except when the officers issued the written authorisation of the transport of animals to a recognised recycling company that deals with aquaculture animal slaughter to control the spread of the disease; 54.5. bivalve molluscs in farms or farming area shall take measures to ensure that infectious disease control. 55. aquaculture animals which have reached commercial size and no clinical signs of infectious diseases, under the supervision of the officers sought to use food or further processing. 56. the collection of aquaculture animals into the dispatch centre or purification centres, further processing or other activities that are part of the preparation process of aquaculture animals before their entry into the food chain, carried out under conditions which prevent the spread of communicable disease agent. 57. dispatch centres, purification centres or similar businesses shall be equipped with an effluent treatment system capable of inactivating the infectious disease agent, which caused the infectious disease or the treatment of waste water, which reduces to an acceptable level the risk of transmitting diseases to the natural waters. 58. further processing of aquaculture animals shall be carried out in an approved processing establishment. 59. The dead fish and dead crustaceans, as well as live fish and live crustaceans that have the infectious diseases clinical symptoms, according to the rules in paragraph 82 that the procedures laid down in the action plan to immediately collect, recycle, used and disposed of under the supervision of the official service in accordance with the European Parliament and of the Council of 21 October 2009. Regulation (EC) no 1069/2009 laying down health rules as regards animal by-products and derived products not intended for human consumption and repealing Regulation (EC) No 1774/2002 (hereinafter referred to as Regulation (EC) no 1069/2009). 60. aquaculture animals which have not reached commercial size and no clinical signs of infectious disease, collected, processed and used under the supervision of the official service in accordance with Regulation (EC) no 1069/2009 as category 3 animal by-products not intended for human consumption, as well as in accordance with the provisions referred to in paragraph 82 of the action plan set out in the agenda, taking into account the type of production and infectious disease further spreading the risk that such animals may increase. 61. After removal of the aquaculture animals from farms or bivalve mollusc farming area and after the infected area for the cleaning and disinfecting of farms or bivalve mollusc farming area is left unused for a period which is sufficient to destroy the infectious disease agent. Service based on a risk assessment and infection disease recurrence, within three working days from the date of the infected area is carried out cleansing and disinfection, shall take a decision on the farm or bivalve molluscs farming areas not used. 62. the service shall determine the appropriate measures to be taken at the farm or mollusc farming area, in order to prevent the spread of infectious diseases among other aquatic animals. These measures include restrictions on the movement of aquaculture animals, the establishment of quarantine before export of aquaculture animals, or import, sewage treatment and other equivalent measures that ensure the infectious disease agent limitation of the infected area. 63. the measures referred to in this chapter, the Department shall continue to apply: 39.2. up to this chapter that measures to combat infectious diseases completion; 39.3. until such time as the existing buffer zone aquaculture industry in particular communicable disease in the appropriate order for samples taken in laboratory studies is not found in the infectious disease agent. VIII. Control and eradication measures after an exotic infectious disease detection aquaculture animals, 64. If the Latvian territory, zone or compartment declared free of those provisions of annex 1, part II, not exotic infectious diseases of the territory, zone or compartment, confirmed an outbreak of infectious diseases, the Department carried out one of the following measures: 64.1. application requirements referred to in Chapter VII, for infectious disease-free status. If this provision is referred to in Chapter VII, clinically healthy aquaculture animals allowed to breed to commercial size to be slaughtered and used in food, or they move to a different area or the infected workstation. During the transfer, take measures to prevent the further spread of communicable diseases; 64.2. develop monitoring and control programme, submit it for approval to the European Commission and implement the measures laid down in the programme. 65. If the Latvian territory, zone or compartment declared free of those provisions of annex 1, part II, not exotic infectious disease affected area, a zone or compartment, confirmed an outbreak of infectious diseases service at the epizootiological situation evaluation decides that the non-exotic diseases intact for the territory, zone or compartment status is recoverable: 65.1. service the farm or bivalve mollusc farming area declared infected; 65.2. around the infected farm or mollusc farming area the service determines the buffer zone, which consists of the protection zone and the surveillance zone; 65.3. the service controls the movement of aquaculture animals from the buffer zones. The buffer zone in the territory of the aquaculture animals are allowed to import farm or bivalve mollusc farming area 3 of these regulations in accordance with the procedure laid down in the annex; 65.4. the area of the buffer zone allowed to gather and slaughter for human consumption of aquaculture animals, if they have reached commercial size, they have no clinical signs of infectious disease and the relevant activities are carried out under the supervision of the official service; 65.5. the dead fish and crustaceans removed and disposed of under the supervision of the official service in accordance with Regulation (EC) no 1069/2009, taking into account the type of production, as well as future infectious disease spreading the risk that such animals may increase. IX. Monitoring and control measures after the exotic and non-exotic diseases detected 66 wild aquatic animals. If it is found wild aquatic animals becoming infected or suspected of being infected with any of the rules referred to in annex 1 of the exotic or exotic infectious diseases Department organized this rule 65. measures referred to in paragraph 1 and shall set the limits, to reduce and prevent the further spread of the infectious disease in bivalve molluscs in farms or farming area. 67. the measures applicable to wild aquatic animals to combat infectious diseases develop, taking into account the epizootiological situation. Service prohibits the placing of aquatic animal catches and aquaculture farms or bivalve molluscs farming areas, determines the movement of aquaculture animals restrictions on farms or bivalve molluscs farming areas are located in the infected area. 68. the service shall inform the other Member States of the European Union and the European Commission on this provision, paragraph 66. X. Monitoring and control measures to the new communicable disease outbreak 69. Service monitoring of aquaculture animals. If you found a new infectious disease, the Department developed and submitted to the Ministry of Agriculture proposals on measures the new infectious disease prevention of the spread of aquaculture animals, and aquatic animals. Ministry of agriculture assessed service proposals, prepare the rules and submitted to Cabinet for approval. 70. where the aquaculture animals emerged, a new communicable disease services within 24 hours from the moment when the established fact of aquaculture animals infected with a new infectious disease, it shall inform the other Member States of the European Union, the European Commission and the European Free Trade Association Member States, if the findings are an epizootiological significance for another State (Latvia's trade relations with the country, the new infectious disease factors are not cleared neighbouring Latvia, the country is, for the control of communicable diseases and control required cooperation with other countries). 71. If the new infectious disease threat in the territory of Latvia, existing aquaculture animal and aquatic animal health status, service this provision in Chapter VII and VIII to these measures, as well as measures to prevent the introduction of the new infectious disease and its control. 72. the service within three working days from the date of this provision have been introduced the measures referred to in paragraph 71, communicate it to the European Commission, as well as to be informed of the measures which may affect trade between the Member States of the European Union. XI. Monitoring and eradication program, the development and operation of 73. If you are not aware that in the territory of Latvia are common in some of the provisions in part II of annex 1 listed non-exotic diseases, and if the territory of Latvia or its part is not rendered for a specific infectious disease (category III in accordance with the provisions of annex 3), the Department developed and submitted for approval to the European Commission, the monitoring programmes for infectious disease-free status. 74. The procedure for taking samples and infectious disease diagnostic rules referred to in paragraph 73 of the supervisory authorities for the implementation of the programme into line with the European Commission. 75. If the rules referred to in paragraph 73 of the monitoring programmes as applied to individual compartments and zones covering less than 75% of the territory of the Republic of Latvia, and the zone or compartment consists of a water catchment area not shared with the other country, such a monitoring programme be approved, amended or repealed in accordance with the provisions of paragraph 93. 76. If it is known that in the territory of Latvia are common in some of the provisions in part II of annex 1 listed non-exotic infectious diseases (category IV in accordance with the provisions of annex 3), the Department developed and submitted for approval to the European Commission programme. 77. the service shall inform the other Member States of the European Union and the European Commission for the monitoring and eradication programmes, which are approved in accordance with this provision and paragraph 73.76 and implemented in the territory of Latvia. 78. The territories in which implement this rule 73 or 76. referred to in the monitoring or eradication programme, ensure that rule 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 47, 48, 49, 50, 51, 52, 53 and 64, paragraph compliance with the requirements. 79. In the monitoring or eradication programme: 79.1. describe infectious diseases epizootiological situation before the start of the programme; 79.2. the calculation for the necessary funds (allocated in the current year national budget and European fish Foundation features) and analyzes the expected benefits; 79.3. determines the duration of the programme and the objectives to be attained by the end of the programme; 49.3. Description of the implementation of the programme of the geographical and administrative area and its boundaries. 80. In the monitoring or eradication programme: 80.1. implemented up to this provision are fulfilled the requirements laid down in chapters XIV and Latvian territory, zone or compartment is declared free of communicable diseases; 80.2. the Department or the European Commission abolished if it is not targeted. 81. If the monitoring or eradication programme in accordance with the provisions of the repealed 80.2. This provision, made 65. measures referred to in paragraph 1. XII. action plan, its activities and the vaccination order 82. Service develops action plan annex 1 of these regulations referred to in the first subparagraph of exotic diseases and emerging infectious disease outbreak. Action plan: 82.1. action to ensure the implementation of the action plan, making a quick and successful infection eradication campaign; 82.2. ensure coordination and compatibility with neighbouring Member States of the European Union and third countries; 82.3. action, such the statutory requirements have been met: 82.3.1. the animal by-products and destruction, not intended for human consumption; 82.3.2. the foodstuffs of animal origin and animal feed and distribution; 82.3.3. trade in live animals, foodstuffs of animal origin and animal feed; 82.4 points detailed management scheme, including infectious disease outbreak prevention in involved State and local authorities to ensure the operational decision making and implementation of decisions; 82.5. measures to ensure the availability of the necessary resources, including financial resources (the Ministry of Agriculture for the current year national budget allocated funds, funds for contingencies, the budget of the European Union means for infectious disease control and eradication measures for repayment of losses due to the Member States of the European Union), effective infectious disease eradication campaign (for example, the laboratory staff, equipment and infrastructure); 82.6. determine the guidelines that specify the practical arrangements for conducting activities in all stages of the eradication of infectious diseases, as well as disinfection procedures; 82.7. provide detailed information on control measures involved required skills and their responsibilities, as well as the necessary personal protective equipment; 82.8. developing a vaccination plan and procedures; provides for eradication measures 82.9. persons involved in the education program on infectious disease clinical symptoms, the epizootiological surveillance, control and eradication of infectious diseases, as well as plans to drill to real events, to develop communication skills and encourage public officials, producers and veterinarians understanding of infectious disease; 82.10 points diagnostic laboratory, equipped for aquaculture animal corpses for serological, virological, ihtiopatoloģisk or other type of investigation. Provide for action to the swift transportation of samples to the laboratory, as well as laboratory analyses of opportunities and resources available for addressing infectious disease outbreak; 82.11. draw up action in cases where the short time needed to control a large number of outbreak; 82.12. define the action to an infectious disease outbreak, without endangering human health and using procedures or methods, which prevent damage to the environment, minimum risk to soil, air, surface and ground water, plants and animals, cause minimal interference noise or odor, as well as a minimum of adverse effects on the countryside or specific points of interest, ensure the aquaculture animal corpses and mass disposal of by-products not intended for human consumption; 82.13. determine the companies that intended to destroy the animal by-products not intended for human consumption. 83. the action plan shall be submitted for approval to the European Commission and after obtaining the assent consent shall be published in the Official Gazette of the "journal". The action plan is updated every five years and submitted for approval to the European Commission. 84. Vaccination against this provision in part I of annex 1 to these exotic infectious diseases is prohibited, except where it is carried out after coordination with the European Commission. The launch of the vaccination campaign service coordinated with the European Commission. 85. Vaccination against this provision in part II of annex 1 listed non-exotic infectious diseases is prohibited in all parts of the territory, which has been declared a communicable disease, as well as areas in which the implementation of the provisions referred to in paragraph 73 of the surveillance program. 86. Vaccination against this provision in part II of annex 1 listed non-exotic infectious diseases is permitted in the territories or parts thereof that have not been declared the particular infectious disease or where vaccination is carried out as part of an eradication programme of infectious diseases. Eradication programme approved in accordance with this provision, paragraph 76. 87. The vaccine of choice in accordance with the regulations on the procedure for the registration of veterinary medicinal products and the European Parliament and of the Council of 31 March 2004, Regulation (EC) No 726/2004 laying down the procedures for the authorisation and supervision of medicinal products for human and veterinary use Community procedures and establishing a European Medicines Agency. 88.85. These provisions and 86. of the type referred to in paragraph 1 shall not apply to research aimed at developing and testing vaccines under controlled conditions. Study on time taken to protect other aquatic animals from any adverse effect of the vaccination carried out within the framework of the studies. XIII. Procedure for the territory of the Republic of Latvia declared the exotic infectious diseases not intact 89. the service shall be submitted to the European Commission for the information you need to claim a place on the territory of Latvia the provisions of annex 1, part II of the non-exotic diseases intact if: 89.1. is not present or the aquaculture aquatic animal species that is susceptible to a particular infectious disease agent; 89.2. it is known that infectious disease agent will not be able to survive in the Latvian territory waters; 89.3. in the territory of Latvia are running this Rule 102.103.104., and the conditions referred to in paragraph 1; 89.4. neighbouring Member States of the European Union have been established by the competent authority as a buffer zone, where the national territory have specific aquaculture animal infectious disease. The delimitation of the buffer zone protects the Latvian territory existing aquaculture animals from infection with infectious disease agent passive transfers. 90. the service creates a buffer zone in the territory of Latvia if the Latvian territory or water catchment area, which is shared with neighbouring Member States, the European Union has established in any of these provisions in part II of annex 1 listed non-exotic infectious diseases and is not declared the territory a particular infectious disease. The delimitation of the buffer zone protects the infectious disease national aquaculture animals from infection with infectious disease agent passive transfers. 91. the size of the buffer zone, its monitoring and sampling procedures in the buffer zone, as well as diagnostic methods used for infectious disease-free status, the Department coordinated with the European Commission. 92. the service declare the zone or compartment for this provision in part II of annex 1 to this exotic infectious diseases not intact if the zone or compartment meets one of the following requirements: 57.2. the waters of the zone or compartment is not present in any of the aquaculture animals or aquatic animal species that is susceptible to a particular infectious disease agent; 92.2. pathogen is known not to be able to survive in the waters of the zone or compartment; 92.3. zone or compartment complies with this provision, 105, 106, 107, 108, 109, 110, 111, 113.112, 114, 116, 115, 117, 118, 119, 120.. 121.122, and the conditions listed in. 93. the European Commission sends the Declaration of the zone or compartment not declared an exotic infectious disease. The Declaration shall be accompanied by the relevant information and documents, and electronically send the rest of the European Union, the competent authorities of the Member States. To consider and adopt the Declaration of the Standing Committee on animal health and welfare, controls and import conditions section. 94. If the zone or compartment, qualifying for an exotic infectious disease-free zone or compartment status, account for more than 75% of the territory of Latvia or, if the zone or compartment consists of a water catchment areas shared with other European Union Member State, zone or compartment such as infectious disease declared by the European Commission. 95. to zone or compartment to outlaw exotic infectious disease, Department of the European Commission, the order in which it performs monitoring and sampling. 96. the Department shall establish, maintain and restore the area and list the precinct are declared without an exotic infectious disease under this provision and paragraph 92.93. The service provides public access to that information. 97. when the territory of Latvia in accordance with the provisions of paragraph 88 is declared without an exotic infectious disease, the Department may suspend the targeted surveillance. The territory of Latvia remains an exotic infectious disease-free status, if those provisions are complied with the conditions referred to in paragraph 89. 98. If the Latvian territory is the area and the station, which is not present in any of these provisions in part II of annex 1 listed non-exotic diseases, but the zone or compartment not declared certain infectious disease as well as the situation where there is not a specific infectious disease clinical development conditions, service targeted surveillance carried out in accordance with this rule 91 or 95 paragraph. 99. If the service finds it breaks one of the conditions to be fulfilled to keep an exotic infectious disease-free zone or compartment, the status of the service: 99.1. stop susceptible aquaculture animal species and infection of vector species trade with other European Union Member States, zones or compartments that have better health status in relation to the specific infectious diseases, and Act 3 of these regulations in accordance with the procedure laid down in the annex; These rules apply to 99.2.47, 48, 49, 50, 51, 52, 53, 64, and 65. the requirements referred to in paragraph 1. 100. where the epizootiological examination, the measures for the application of this provision in paragraph 99 above, finds that the service is not a violation of any condition, which must be performed to keep the infectious disease in the territory of a Member State, zone or compartment, for the territory of the Republic of Latvia, the concerned zone or compartment to renew the infectious disease-free status, zone or compartment. 101. where the epizootiological examination, the measures for the application of this provision in paragraph 99 above, the service finds it breaks one of the conditions to be fulfilled to keep the infectious disease in the territory of a Member State, zone or compartment status, such status is revoked. Before infectious disease-free status for restore performance that the requirements referred to in Chapter XV. XIV. Bio-security measures and requirements for the territory of the Latvian State, area and district, to outlaw the infectious disease 102. Biosecurity measures are the following: 102.1. aquaculture animal owner or holder shall inform the territorial departments of the service for the detection of infectious diseases or suspicion thereof being the abode of aquaculture animals (farm or mollusc farming area); 102.2. introduced infectious diseases early detection system that allows the Department to conduct the investigation of infectious diseases and ensure rapid 102.2.1.: clinical signs of infectious disease recognition, which leads to the suspicion of infectious disease, as well as provides quick detection of new infectious diseases or the unexplained mortalities aquaculture animals investigation nurseries bivalve mollusc farming areas and populations of wild aquatic animals; 102.2.2. rapid reporting service to start as soon as possible of the diagnostic investigation. 103. This rule 102.2. referred to the infectious diseases early detection system ensures that: 103.1. aquaculture production business or the processing of aquaculture animals business employee understanding of infectious diseases, the clinical signs or suspicion of disease of aquaculture animals is sufficient; 103.2. veterinarians and aquatic animal health experts are trained to detect unusual infectious diseases, can recognize suspicious cases of infectious diseases and report on them to the territorial unit of the service; the service is available to 103.3. adequately equipped laboratory to diagnose these rules referred to in annex 1 of aquaculture animals, infectious diseases, as well as new, not referred to in these provisions of the infectious disease. 104. the national territory declared an infectious disease: 104.1. based on targeted surveillance, as well as: 104.1.1. the last 10 years before the disease infection in the territory of Latvia's status has not been clinical infectious disease outbreak; 104.1.2. the area of infection status was unknown; 104.2. If in accordance with the provisions of paragraph 102 is taken biosecurity measures; 104.3. If in accordance with this rule 91 shall not less than two years is carried out targeted supervision and during this period the bivalve molluscs in farms or farming area no infectious disease agents. If a part of the territory of Latvia or bivalve molluscs in farms farming area targeted monitoring does not provide enough epizootiological data, targeted surveillance shall also apply to existing wild populations of aquatic animals, if it contains one or more animals of susceptible species. 105. the service shall determine the boundaries of the zone and its map, based on one of the following criteria: 105.1. area is all the water catchment area from the source to the mouth; 105.2. zone is part of a water catchment area from the source to the natural or artificial barrier that prevents the migration of wild aquatic animals to the top of the lower stage of a water catchment area; 105.3. zone has several water catchment and estuary, where they are associated with the epizootiological water catchment area. 106. the service is not allowed to proclaim the area of infectious disease, if it extends into neighbouring territory of a Member State of the European Union, except when the entire area is filled, this provision, 108 and 107.109. the conditions referred to in points and both Member States of the European Union asked the European Commission to register as an infectious disease the zone, which is located in each Member State of the European Union territory. 107. Infectious disease status is obtained, if these rules are met, paragraph 104. 108. a zone where the last known clinical infectious disease outbreak occurred more than 10 years before infectious disease status or the award of the State of contamination before the targeted surveillance was unknown, considered as infectious disease, and service it organizes measures to ensure that the requirements referred to in paragraph 104. 109. the service creates a buffer zone in which a monitoring programme is implemented. The buffer zone is delimited by, to thwart the infectious disease agent passive importation of the disease affected area. 110. the service shall determine the boundaries of the district and its map. 111. the station, which is against the infection of susceptible species, but in the last 10 years before the infectious disease of the circuit status not found infectious disease outbreak, despite conditions that contribute to the development of clinical infectious disease, is considered infectious disease if the station meets the following requirements: 111.1. not less than in the last 10 years are taken biosecurity measures in accordance with the provisions of paragraph 101; No information about specific 111.2. the incidence of infectious disease in wild aquatic animals; 111.3. implemented effective trade and imports conditions to prevent the importation of infectious diseases in the territory of Latvia. 112. Infectious disease-free status of the circuit, if these rules are met, paragraph 104. 113. the station that last 10 years before the infectious disease of the circuit status not found in clinical infectious disease outbreak or where the surroundings are station or waters of the State before the start of a targeted surveillance was not known to be considered infectious disease, and service it organizes measures to ensure that the conditions referred to in paragraph 104. 114. The station, which implemented a monitoring programme for each farm or mollusc farming area of bivalve: 114.1. service by a buffer zone; 114.2. the officers of the specific measures to prevent infectious diseases from entering and spreading. 115. The station, comprising one or more farms, of which the animal health situation for aquaculture animals in relation to the specific infectious disease does not depend on the State of health in relation to the surrounding waters are: 115.1. individual farms, considered as one unit, because the epizootiological does not affect the aquatic animal health status; 115.2. more farms if they are included under a common biosecurity system and each farm station complies with this provision and in 115.1 116, 117, 118, 119.. and in paragraph 120 above requirements, but a broad movement of aquaculture animals between farms it is regarded as one of the epizootiological unit. 116. in the water supply station: 116.1. using the water supply device that deactivates the particular infectious disease agent, reducing the risk of spreading infectious disease to an acceptable level; 116.2. exactly by a well, a borehole or a spring. Where such water supply established outside the territory of the farm water supply directly to the farm through the pipe. 117. The station is natural or artificial barriers that prevent aquatic animals surrounding bodies of water to get any of the circuit for farms. 118. the station shall be protected from flooding and the surrounding waters of the inlet water. 119. The station shall apply this provision, paragraph 104. 120. The station shall take measures to prevent the entry of infectious disease vectors (controls the location of the station, let only clinically healthy and kept in quarantine for aquaculture animals for aquaculture animals are getting into an appropriate State of health). 121. If a new Kennel complies with this provision and in 117 116.1., 118, 119 and 120.. the requirements referred to in point and is located in the station, which declared the infectious disease, the farm is considered infectious disease and it doesn't take the samples needed infectious disease-free farms for the approval status. 122. If the kennel which complies with this provision and in 117 116.1., 118, 119 and 120.. the requirements referred to in paragraph, resumed after a break and in the station, which declared an infectious disease, Kennel not necessary for infection disease-free farms for the approval status, in this case: 122.1. officers of the health history of the farm is known for the last four years (if the farm running in less than four years having regard to its real life); 122.2. Kennel will not be subject to the rules referred to in annex 1 of the infectious disease control measures and infectious diseases in this farm is not established; 122.3. before aquaculture animals, eggs or gametes of the farm is cleaned and disinfected, and has not been used for some time. XV. monitoring the organisation of aquaculture industry 123. Service of bivalve molluscs, the farm or farming area shall be assessed according to the degree of risk, taking into account the likelihood of the spread of infectious diseases to other farms or bivalve molluscs farming areas. Service of bivalve shellfish farm or growing zone grant high-risk: 123.1. There is a substantial likelihood of the spread of infectious diseases to other farms or wild aquatic animal populations or become infected with those from other farms or wild aquatic animals (intensive movement of aquaculture animals between farms, especially those that have no particular status in relation to infectious diseases or suspected infectious diseases); 123.2. rearing conditions increases the risk of outbreaks of infectious diseases (large amount of biomass (aquaculture stocking densities greater than 60 kg/m3 of water), water quality is low (water in laboratory studies, the total number of micro-organisms found two times and more exceeds the allowable water microbiological pollution)); 123.3. life aquatic animals are sold for further farming or restocking. 124. A medium level of risk of bivalve shellfish farm or growing zone service granted if: a medium likelihood 124.1. spread infectious diseases to other farms or wild aquatic animal populations or are likely to be infected from other farms or wild aquatic animal resources (going on the movement of aquaculture animals between farms, which have no particular status in relation to infectious diseases); 124.2. growing conditions do not increase the risk of infectious disease outbreaks (medium biomass volume (density of aquaculture animals is 30-60 kg/m3 of water), water quality is medium (water in laboratory studies, the total number of micro-organisms found one to two times the microbiological contamination of water margins)); 124.3. life aquatic animals are sold for human consumption. 125. the low level of risk of bivalve shellfish farm or growing zone service granted if: there is little likelihood of 125.1. spread the infection to other farms or wild aquatic animal populations or not likely become infected from other farms or wild aquatic animal resources (going on the movement of aquaculture animals between farms that have a particular status in relation to infectious diseases); 125.2. growing conditions do not increase the risk of outbreaks of infectious diseases (low biomass volume (density of aquaculture animals are up to 50 kg/m3 of water), good water quality (water in laboratory studies revealed the total number does not exceed the micro-water microbiological pollution norms); 125.3. life aquatic animals are sold only for use in food. 126. in implementing the passive monitoring of aquaculture animals, the owner or the holder shall be obliged to immediately notify the territorial departments of the service in aquaculture animals disease and mortality. After notification, take this rule 47, 48, 49, 50, 51, 52 and 53. measures referred to in paragraph. Information about the disease and mortality of aquaculture animals, the owner or keeper shall provide the medical practitioner or authorised veterinarian. 127. the active monitoring includes: 127.1. regular checks carried out by officers or authorized veterinarian; 127.2. aquaculture animal population in relation to infectious diseases; 127.3. sampling for laboratory examinations, if you suspect any of these rules referred to in annex 1. communicable diseases or have found increased mortality; 127.4. reporting service territorial unit if the laboratory studies in aquaculture animals found infectious disease or suspicion thereof; 127.5. territorial unit information on mortality. Information on mortality give aquaculture the owner or keeper of the animals to the veterinarian or an authorised medical practitioner. 128. The targeted surveillance include: 128.1. officers carried out regular checks; 128.2. sampling for laboratory studies to determine the specific pathogens; 128.3. reporting service territorial unit if the laboratory studies in aquaculture animals found infectious disease or infectious disease is suspected; 128.4. information on territorial Department of aquaculture animals, the mortality. XVI. The claim of the quarantine station and quarantine management conditions 129. to register the quarantine: 129.1. natural or legal persons shall submit the application for the service; Service: 129.2.129.2.1. economic operator issued requirements for the quarantine station; 129.2.2. looking documents and assess compliance with quarantine rules in chapter XVI requirements; 129.2.3. three working days in writing of the decision taken in the quarantine facility. 130. If the quarantine testing finds: non-compliance with this rule 130.1. XV requirements contained in chapter III, the officers did not record the quarantine period and shall fix a time limit for the prevention of abuse. That date officers shall coordinate with the quarantine station owner; 130.2. compliance with this provision in chapter XVI of the above requirements, the service registers the quarantine officials, giving the registration number, and after the owner of the quarantine request, provide a certificate of registration. The list of services registered in the quarantine station and the information Insert the tīmekļvietn. 131. the economic operator shall establish quarantine as a separate company or be the farm or mollusc farming area. 132. The quarantine facility is located within a certain distance of the service from other points of quarantine for farms or mollusc farming areas. Service distance between quarantine and other premises, farms or mollusc farming areas shall be based on a risk assessment and taking into account this provision 1. aquaculture animals referred to in the annex to the epizootiology of infectious diseases. 133. The quarantine unit shall be so arranged that, between them would be impossible water exchange. Water discharge system designed to prevent the quarantine unit of the same or another farm or mollusc farming area of the territory of the cross-contamination. 134. The quarantine units deliver water that has this rule 1. aquaculture animals referred to in the annex to infectious disease agents intact. 135. the quarantine facility Where aquaculture animal infectious diseases (annex 1) intact in the Latvian territory, zone or compartment (these provisions have been complied with chapter XIII of such requirements or in the territory, zone or compartment is aquaculture animal infectious disease surveillance or eradication programme), sewage treatment system, it shall, subject to the following requirements: 135.1. the system provides all the quarantine unit generated waste and waste water treatment, it to effectively eliminate this rule 1. aquaculture animals referred to in the annex to infectious disease agents; 135.2. system is equipped with a backup safety mechanism that ensures continuous operation and complete its sewage treatment. 136. The quarantine unit shall be so arranged as to prevent animals in quarantine in contact with other animals that can spread infectious diseases of aquaculture animals, agents. 137. the quarantine station and quarantine unit equipment shall be so arranged that they can be cleaned and disinfected. The equipment is appropriate for the cleaning and disinfection equipment. 138. At the quarantine station and quarantine of entry and exit of the unit positioned with disinfectant liquid-soaked carpet to destroy infectious diseases of aquaculture animals, agents. 139. Each quarantine unit shall be equipped with separate equipment to prevent cross-contamination of the quarantine unit. 140. The quarantine station owner contracts with a professional veterinarian. 141. before each new consignment of aquaculture animals into the quarantine unit it clean and disinfected, and not less than seven days there. 142. The quarantine time starts after all the records in the consignment of aquaculture animals into the animal quarantine unit. 143. The quarantine facility shall take measures to prevent the received and sent consignments of aquaculture animals cross-contamination. 144. the quarantine station and quarantine unit allowed to enter people who perform with quarantine of aquaculture animals-related duties. 145. Entering the quarantine station and quarantine unit, persons wearing protective clothing and safety shoes. 146. There must be contact between the staff or equipment which cause cross-contamination between the quarantine or under quarantine units or between points of quarantine and for farms or mollusc farming areas. 147. After receipt of the consignment of aquaculture animals, vehicles, equipment, tanks, containers and water treatment to destroy infectious diseases of aquaculture animals, agents. 148. the sampling, testing, laboratory investigations and diagnosis is carried out by an official veterinarian pursuant to the instructions of the service. 149. in addition to these rules 15, 16, 17 and 18 that quarantine memorise recorded: 149.1. the time when employees enter and exit from it; 149.2. delivered in water and waste water treatment; 149.3. all emergency conditions affecting quarantine process (for example, power breaks, building damage, emergency weather); 149.4. check submitted to the date of sampling and testing results. XVII. claim of aquaculture animals imported for quarantine before release for 150 European Union waters. If Latvia imports (from third countries) the aquaculture animals for quarantine, the importer or his representative shall submit to the Department a written assurance that the designated quarantine station for imported aquaculture animals placed in quarantine and will be adopted in accordance with the requirements of this Regulation (hereinafter referred to as the Declaration). Proof of the signature of the quarantine station owner or his authorized person. 151. in the Receipt indicating the registration number of the quarantine station. Evidence presented in Latvian language or its European Union Member State in which the border inspection post of the veterinary checks carried out and add the official translation Latvian language. If the imported from third countries consignments of aquaculture animals for the Republic of Latvia, the proof shall be made according to the laws of the country. 152. The importer or his representative shall take one of the following: 152.1. submit proof of the border inspection post of the consignment of aquaculture animals before going into it; 152.2. produce evidence at the border inspection post before the release of aquaculture animals from the border inspection post. 153. the aquaculture animals imported from the border inspection post is transferred directly to the quarantine station. If such vehicles are used for transport, post Service Officer vehicles imposed a tamper-proof seal. 154. in the quarantine of imported aquaculture animals: 154.1. officers of the border inspection post, using computerized information reporting system (TRAC) (according to the legislation on veterinary checks procedures to be followed for the importation of the animals in Latvia from third countries, and the Commission of 30 March 2004, Regulation (EC) no 599/2004 concerning the adoption of a harmonised model certificate and inspection report linked to intra-Community trade in animals and products of animal origin) one of the working days, inform the officers that are located under the supervision of a quarantine facility, indicating the date of consignment of aquaculture animals at the border inspection post is received, the place of origin and destination; 154.2. the quarantine facility owner or his authorized person one day After receipt of the consignment of aquaculture animals in quarantine facility shall inform the officers that the supervision of quarantine station is located on the mailing receipt (also, where the consignment has been received within the prescribed time); 154.3. officers, which is located under the supervision of a quarantine station, three working days (from the date of shipment of aquaculture animals imported in quarantine area) using the traces system, inform the officers of the border inspection post of arrival of the consignment (also, where the consignment has been received within the prescribed time). 155. When a border inspection post Service Officer receives information that the aquaculture animals declared as to send to quarantine, no destination within three working days after the date of arrival specified, it shall inform the customs services and the authority of that fact. Service in cooperation with the Customs authorities to take measures to ensure cargo and placing in quarantine. 156. to aquaculture animals placed on the market in accordance with the provisions of article 34, 35 or 39. or consignments of aquaculture animals imported in accordance with the Commission on 12 December 2008, Regulation (EC) No 1251/2008, implementing Council Directive 2006/88/EC as regards the conditions and certification requirements for aquaculture animals and products thereof on the market and importation into the community and referred to in the list (hereinafter referred to as Regulation (EC) No 1251/2008) Chapter IV, the aquaculture animals must meet the following requirements: 156.1. all quarantine time post in the same quarantine station; 156.2. the aquaculture animals of species susceptible to the diseases in aquaculture animals, subject to this provision 160.162, 163, 164, 165.., 166 and 167. the requirements referred to in paragraph; 156.3. the aquaculture animals species that are infectious diseases of aquaculture animals, vectors, applies this rule 161, 162 and 163. the requirements referred to in paragraph; 156.4. quarantine officers by the end of each consignment of aquaculture animals shall be completed and issued legislation that specifies information about the quarantine, the quarantine time, aquaculture species, number of animals, the destination of the consignment, as well as proof that the aquaculture animals are clinically healthy and have not found the provisions referred to in annex 1 of aquaculture animal infectious diseases. 157. If during quarantine suspected disease of aquaculture animals, by any of the rules referred to in annex 1 of aquaculture animal infectious diseases service officer: 157.1. samples and investigate the aquaculture animal infectious disease reference laboratory to confirm or reject the existence of infectious disease; 157.2. diagnosis for approval or rejection shall prohibit the introduction into the quarantine station and from there exported aquaculture animals. 158. If during quarantine in an approved of these rules referred to in annex 1 of aquaculture animal infectious diseases, officers controls the following requirements are met: all quarantine unit 158.1. existing aquaculture animals shall be removed and disposed of under the relevant infectious diseases spread, except when aquaculture animals and products thereof placed on the market and the quarantine Unit found in the aquaculture animal infectious disease does not jeopardise the health status of aquatic animals in the territory or country of destination; 158.2. infectious diseases quarantine affected units are cleaned and disinfected; 158.3. the 15 days after the quarantine unit cleaning and disinfection is complete it is prohibited to insert aquaculture animals; 158.4. infectious diseases quarantine units affected water treated and disinfected to destroy identified aquaculture animal infectious disease agent. 159. the service shall inform the European Commission of measures implemented in accordance with the provisions of paragraph 157.158. and. 160. Animal species susceptible to infectious diseases of aquaculture animals, ensure that the quarantine time: 160.1. fish: not less than 60 days; 160.2. crustaceans – not less than 40 days; 160.3. molluscs: not less than 90 days. 161. animal aquaculture species which are infectious animal disease vectors, quarantined there not less than 30 days. During this time, the water in the quarantine unit change at least once a day. XVII. Control 162. during quarantine service animal quarantine of aquaculture at the beginning and end of time controls the quarantine conditions are met. Controlling to aquaculture animal infectious diseases susceptible species, the service supports the environmental conditions that promote these rules 1. aquaculture animals referred to in the annex of the detection of infectious disease laboratory studies. 163. the quarantine control, inspection of conditions: 163.1. dead animals during quarantine; 163.2. health status of aquaculture animals in a quarantine unit. 164. To demonstrate this rule 1. aquaculture animals referred to in the annex of the absence of infectious diseases, laboratory examination results will be negative. Service veterinarian, following the service of the sampling procedures, as well as the transport and diagnostic process, samples shall be taken in circumstances that contribute to this infectious disease. Samples for 15 days before the end of the quarantine time taken: 164.1. Sentinel animals from all aquaculture if such use during quarantine; 164.2 of the appropriate number of aquaculture animals in order to ensure the appropriate list of detection of infectious diseases with a confidence level of 95% if the prevalence in the pattern is 10% and if the Sentinel animals are not used in aquaculture (but not less than 10 aquaculture animals). 165. aquaculture of Sentinel animals allowed to use analysis, sampling and diagnosis, except when there is a quarantine of aquaculture animals of species susceptible to the agent marteiliosis Marteilia refringens. 166. During quarantine service determines the number of Sentinel animals in aquaculture, taking into account the quarantined by the number of aquaculture animals quarantine unit size, species characteristics and aquaculture of the infectious animal disease. 167. Service control to quarantined aquaculture Sentinel animals shall meet the following requirements: 167.1. Sentinel animals are specimens of species that are susceptible to these rules referred to in annex 1. aquaculture and infectious animal diseases, taking into account their range conditions are in the development phase, when susceptibility to these diseases is highest; 167.2. Sentinel animals originating in the territory of a Member State, zone, compartment or in a third country or a part thereof is relevant to aquaculture animal infectious disease; 167.3. Sentinel animals have not been vaccinated against the diseases of aquaculture animals; 167.4. Sentinel animals are placed in the quarantine unit just before the quarantine of aquaculture animals in the receipt or its time and held together with aquaculture animals and imported in the same breeding and environmental conditions. 168. the dead or sick animals investigates aquaculture service veterinarian. 169. If, in accordance with Regulation (EC) No 1251/2008, chapter IV quarantine is the condition of the consignment of aquaculture animals for import of such consignments are imported, if the third country has complied with the requirements of legislation for the equivalent of aquaculture animal quarantine requirements. XIX. claim of viral haemorrhagic septicaemia and infectious haematopoietic necrosis of surveillance and eradication program in order to obtain and maintain the health status of aquaculture animals "infectious disease" and the infectious disease containment measures 170. Viral haemorrhagic septicaemia and infectious haematopoietic necrosis monitoring includes the following activities: 170.1. General aquaculture and aquatic animal health checks under paragraph 170 of these rules; 170.2. a specific aquaculture and aquatic animal health checks under this provision 172.173.174, 175, 176., 177, 178, 179, 181, 182, 190.183, 184, 185, 186, 187, a. a. and in paragraph 188, for category I, State of health, "infectious disease" (category I); 170.3. aquaculture and aquatic animal health checks under this provision and 189, 190.191. point to keep the category I; 170.4. the aquaculture and aquatic animal health checks, the purpose of which is to remove the containment measures for the territory of Latvia, station or area with respect to the viral haemorrhagic septicaemia or infectious haematopoietic necrosis has been assigned to the health situation of the corresponding category V (V class), you can assign the appropriate health category III (category III) under this provision in paragraph 192. 171. Viral haemorrhagic septicaemia or infectious haematopoietic necrosis detection organizes General aquaculture and aquatic animal health checks in the following order: 171.1. aquaculture animal health check organised or sampling season, when the water temperature is lower than 14 ° C, or at any time when the water temperature could have reached the year's lowest value; 171.2. the part that bivalve molluscs in farms or farming area is not much and the targeted surveillance does not provide enough epizootiological data but that is one or more animals of susceptible species populations of wild aquatic animals, the targeted surveillance. Number of sampling points and the geographical distribution down to cover the national territory, zone or compartment. Sampling points representing a variety of ecosystems that are against infectious diseases in aquaculture animals of susceptible species populations of wild aquatic animals; 171.3. farm or wild aquatic animal populations where health check organised or sampled more than once a year, between the health checks and sampling times followed for four months or longer intervals, depending on the rules of 171.1. the requirements referred to in point for water temperature; 171.4. aquaculture animal health checks shall be carried out in all production units – such as ponds, tanks, cages, nets and see if the unit is not dead or weakened fish or fish with abnormal behavior. A special focus on water in the exhaust area, which weakened fish streams usually builds up more; 171.5. animals of susceptible species of fish samples, choose the following: 171.5.1 of the fish, among which is the rainbow trout, the only species in the sampled fish, if no other susceptible species, which exhibit typical viral haemorrhagic septicaemia or infectious haematopoietic necrosis. If rainbow trout are not, take a sample from all other represented the susceptible aquaculture animal species; 171.5.2. If the found weakened fish, fish with abnormal behavior or recently dead, but not decayed fish, choose the recently dead fish. If fish farming uses more than one water supply source, the sample included fish from all water sources; 171.5.3. fish it sampled, the samples are represented proportionately in all parts of the farm, as well as all age groups of fish. 172. In the case of viral haemorrhagic septicaemia and infectious haematopoietic necrosis for category I: 172.1. Latvian territory, separate its zone or compartment to which the case of viral haemorrhagic septicaemia or infectious haematopoietic necrosis or both of those infectious diseases of aquaculture animals is a category III according to health status and in which the nursery with the susceptible aquaculture animal species and sampling points in the population of wild aquatic animals implement the monitoring program. After monitoring the implementation of the programme for the territory of Latvia, its zone or compartment the service granted category I; 172.2. Latvian territory, separate its zone or compartment to which the case of viral haemorrhagic septicaemia or infectious haematopoietic necrosis or both of those infectious diseases aquaculture animals are appropriate to the category V health status and in which the nursery with the susceptible aquaculture animal species and sampling points in the population of wild aquatic animals, implement an eradication programme of infectious diseases. 173.172.1. These provisions referred to in the monitoring programme shall be implemented in two to four years. 174. in implementing the two-year surveillance program, farms or sample points of wild aquatic animals in two consecutive years organized health checks and, subject to this provision in annex 4, take samples for laboratory examinations, these provisions of annex 5, paragraphs 2 and 3 in the order off any suspected viral haemorrhagic septicaemia or the infectious haematopoietic necrosis, or both of these infectious diseases. 175. in implementing the four-year surveillance program, farms or sample points of wild aquatic animals in four consecutive years organized health checks and, subject to this provision in annex 6, take samples for laboratory examinations, these provisions of annex 5, paragraphs 2 and 3 in the order off any suspicion of viral haemorrhagic septicaemia or infectious haematopoietic necrosis, or both of these infectious diseases. 176. If two-or four-year monitoring during the implementation of the programme in one of the farms is confirmed infection with the viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both of those infectious diseases service cancelled the farm category II. 177. the service can restore the farm category II and allow continuing monitoring program, for category I, not implementing this rule 179, 180, 181, 182, 183, 184, 185,..., 186 and 187.188, referred to in point program, where farm meets the following conditions: 177.1. is continental kennel in which the animal health situation for aquaculture animals for the viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both of those infectious diseases in accordance with the provisions of paragraph 113 is independent of the surrounding natural waters existing populations of wild aquatic animal health status in relation to these infectious diseases; 177.2. is emptied, cleaned, disinfected and kept unused for not less than six weeks; 177.3. its stock is renewed with the fish obtained in European Union Member States, zones or compartments where for the viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases are a particular category I. 178. the territory of the country, zone or compartment to which the case of viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases are a particular category V, class I may be obtained if all farms where applicable in the territory of the country, zone or compartment is kept in the susceptible aquaculture animal species, is implemented in the program. 179. in implementing the program: 179.1. exotic infectious diseases of aquaculture animals, finding out that provision referred to in Chapter VIII of the control and eradication measures and: 179.2. under this provision in 52.2 requirements creates a buffer zone, which includes the protection zone and the surveillance zone; 179.3.180. these provisions, 181, 182, 183, 184.., 185, 186, 187 and 188. measures referred to in paragraph. 180. The buffer zone shall be determined in each individual case of contamination, taking into account the risk factors that influence the spread of infectious diseases in farmed fish hatchery and wild fish populations: 180.1. mortality (by number), mortality and the breakdown by species and diseases (viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases) in the infected farm; 180.2. the distance to the neighborhood nursery and stocking level; 180.3. distance to the nearest recycling companies; 180.4. contact existing farms; 180.5. farms represented species; 180.6. infectious diseases in affected farms and nurseries in the vicinity used cultivation practice; 180.7. hydrodynamic conditions and other epizootiological significance identified factors. 181. When you create a protection zone and surveillance zone around the infected farms in the officially declared, which found the viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases, comply with the following minimum requirements: the geographical delimitation of 181.1. around the farm shall establish a protection zone, in: 181.1.1. coastal area corresponds to a circle delimited area, which is one of the tidal RADIUS bandwidth or five kilometres (uses the largest value), or delimit, the equivalent of the territory determined on the basis of the hydrodynamic or epizootiological data; 181.1.2. Inland territory corresponds with the farm cordoned off the entire catchment area. Service area may be restricted to the extent of catchment areas or parts of the territory of the farm, if this does not impair the viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both of these infectious disease prevention; 181.2. around the farm the surveillance zone that corresponds to the coastal areas of comprehensive protection zone territory observed tidal bar area, or circle of comprehensive protection zone territory 10 kilometres of the Centre of the protection zone or an equivalent area determined according to appropriate hydrodynamic or epizootiological data; 181.3. inland area meets the extended area outside the established protection zone. 182. The protection zone in existing farms, keeping the susceptible aquaculture animal species that do not officially declared as infected with the viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases, conduct official investigation: 182.1. laboratory examinations take 10 samples of fish, if you have seen viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both of those infectious diseases specific clinical or postmortem (post mortem) signs or at least 30 fish samples, if there is no observed clinical signs or post-mortem; 182.2. protection zone for this provision in the order referred to in paragraph 185 of organized health check season when water temperatures exceed 15 ° C. After health checks, depending on the results of laboratory studies continue to perform once a month, unless the fish pond or the network is not covered in the ice cage. 183. all nurseries, which are officially declared to be infected with the viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases, emptied, cleansed, disinfected and uses no less than six weeks. When all the same protection zone officially declared infected farms have been emptied, followed in no less than three weeks ' synchronize the inactivity period. When officially declared infected in nurseries has passed non-use period, the protection zone into the surveillance zone. 184. the resulting protection and surveillance zones to other nurseries may apply requirements of its empty, cleaned, disinfected, and do not use if you are observed for infectious disease outbreaks in the future in other non-infected farms so far. Do not use length of service determines the assessment of the risk of infection to the farm in each individual case, but it is not less than six weeks. 185. All officially declared in the infected farms and all other this provision in paragraph 173 in the protection and surveillance zones in existing farms that kept unused, renew fish stocks resulting from the Latvian territory, zone or compartment, with respect to the viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases are a particular category I. 186. The items restored only after all officially declared infected farms have been emptied, cleaned, disinfected and their non-use period according to this provision, paragraph 183. 187. On all farms that program in the State of the territory, zone or compartment is kept in the susceptible aquaculture animal species, and, if necessary, monitoring the population of wild aquatic animals, to those sampling points in the population of wild aquatic animals, designated in accordance with the provisions of paragraph 171, after the implementation of the programme subject to the two-or four-year surveillance program and this rule 174.175, 176, 177 and the requirements referred to in paragraph. 188. Continental to workstation consisting of a single farm that does not affect the surrounding natural waters and associated with the viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both of those infectious diseases has been cancelled, I can restore it, if the following conditions are met: 188.1. compartment is empty, cleaned, disinfected, and will not be used for at least six weeks; 188.2. restore fish stocks with the fish, which come from the territory of the Republic of Latvia, the zone or district in which the case of viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases are a particular category I. 189. If I need to store the targeted surveillance in all farms that Latvian territory, zone or compartment is kept in the susceptible aquaculture animal species, organized health checks and take samples of the fish in accordance with the provisions of annex 7., depending on the risk for contamination with infectious diseases. 190. The station, in which a certain category I and the Mainland area, the risk of being infected with the viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both of those infectious diseases considered high if the health situation there is dependent on the surrounding natural waters existing populations of wild aquatic animal health. This assessment takes into account in determining the health checks in those precincts. 191. Category I saved until the all the samples that were tested using these provisions of annex 5, paragraph 2, set out in diagnostic methods have produced negative results as regards the viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both infectious diseases and excluded any suspicion about them using this provision of annex 5, paragraph 3 a specific diagnostic methods. 192. the territory of the country, zone or compartment, which related to the viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases are a particular category V, category III may be obtained if: 192.1. these provisions have been complied with 178.179, 180, 181, 182, 183 and 184, the requirements referred to in paragraph. If for technical reasons it is not possible to comply with the period of use, the applicable territory, zone or compartment shall implement any alternative measures that provide equivalent infectious haematopoietic necrosis virus, viral haemorrhagic septicaemia virus or the destruction of both the farm environment; 192.2. officially declared in the infected farms and all other protection and surveillance zones in existing farms which have expired or the period of use is not implemented this provision 192.1. referred to alternative measures, stocks are restored with the fish obtained in the territory of the Latvian State, zone or compartment, which related to the viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both of those infectious diseases established category I, II or III; 192.3. nursery stocks only after all officially declared infected farms have been emptied, cleaned, disinfected and is not the end of their period of use or implementation of these rules is 192.1. alternative measures referred to. XX. claim of the herpes koij disease monitoring and eradication program in order to obtain and maintain the health status of aquaculture animals "infectious disease" and the infectious disease containment measures 193. supervision of the herpes disease Koij includes the following activities: aquaculture and aquatic animal 193.1. General health checks under this rule 193.194, 195, 196, 197, and 198... paragraph; 193.2. specific aquaculture and aquatic animal health checks under this rule 200.201, 202, 203, 204, 205.206, 207, and point to get the category I; 193.3. aquaculture and aquatic animal health checks under this provision, 208, 209, 210.211. a. and 212. point to keep the category I; 193.4. aquaculture and aquatic animal health checks, according to paragraph 213 of these regulations, to cancel the containment measures and the territory of Latvia, station or area, which related to the herpes disease koij assigned category V could be assigned to category III. 194. in implementing the targeted surveillance in wild aquatic animals population, the number of sampling points and the geographical distribution down to cover the national territory, zone or compartment. Sampling points representing the different ecosystems – rivers and Lakes system where wild aquatic animals susceptible populations. 195. in implementing the targeted surveillance, the season when the water temperature has reached at least 15 ° C, but not earlier than two weeks from now, regularly monitor wild aquatic animals of susceptible species the place of stay. Sample and laboratory investigation takes place of monitoring found the sick fish or fish with abnormal behavior. 196.195. These provisions referred to in paragraph 1 within the framework of the monitoring targeted samples taken from fish, at least two to three weeks kept 15 to 26 ° c. If the targeted monitoring of the fish within it is not possible to take samples, as is mentioned above, the sampled in one of the following cases: 196.1. when fish are transferred from winter to summer ponds that collect subpopulācij that keep the same summer the pond until the temperature meets the minimum requirements; 196.2. fish harvesting or during the time the fish of other manipulations according to normal farming practice. To the herpes disease koij detection option would be higher if possible, samples, collected 24 to 72 hours after the relevant manipulations. 197. If a farm or wild aquatic animal populations in targeted health check organised or samples are taken more often than once a year, with long intervals do season when the water temperature could have reached the highest of the year, but not more than 28 ° C. 198. Targeted health checks shall be carried out in all production units – ponds and tanks, to find out if they are not dead or weakened fish or fish with abnormal behavior. Collect the carpi and its hybrid Cyprin (such as the carpi in the × Carassi Cyprin auratus), if any nursery. 199. Targeted health check samples of fish to be taken shall designate the following: 199.1. in view of the weakened fish, fish with abnormal behavior or recently dead, but not decayed fish, if any are present; 199.2. If the cultivation of fish in using more than one water source, samples include fish from all water sources; 199.3. the fish takes it to the sample would be represented proportionately in all parts of the farm, as well as all age groups of fish. 200. the territory of the country, zone or compartment, which related to the herpes disease koij is assigned to category III, the class I may be obtained if the country, zone or compartment that is held against the herpes koij susceptible aquaculture animal species: 200.1. all farms meet the rule requirements contained in chapter XIV; 200.2. all farms implement two-or four-year surveillance programme, which also apply to the sampling points in the population of wild aquatic animals, when part of the territory of Latvia or bivalve molluscs in farms farming area targeted monitoring does not provide enough data and epizootiological if aquatic animal populations in one or more animals of susceptible species. 201. in implementing the two-year surveillance program, farm or sampling point in wild aquatic animals in two consecutive years: 201.1. organized health checks and take samples in accordance with the provisions of annex 2 of the 8 (A) the requirements set out in the table; 201.2. samples laboratory investigates this provision of paragraph 2 of Annex 8 contains the diagnostic method to annex 8, paragraph 3 of the order off any suspicion of disease Herpes koij. 202. in implementing the four-year surveillance program, farm or sampling point in wild aquatic animals in four consecutive years: 202.1. organized health checks and take samples in accordance with the provisions of annex 2 of the 8 requirements set out in table B; 202.2. samples laboratory investigated using this provision, paragraph 2 of Annex 8 contains the diagnostic method for Annex 7 paragraph 3 of the order off any suspicion of disease Herpes koij; 202.3. can be used for monitoring smaller sample in accordance with the provisions of annex 2 of the 8 requirements set out in table B. 203. the farm where the four-year monitoring during the implementation of the programme has been confirmed infection with the herpes koij and has canceled category II, it can recover and continue monitoring the implementation of the programme, for category I, not implementing the program, if the Kennel: 203.1. is continental Kennel where the health status regarding the herpes disease koij is independent of surrounding natural water existing populations of wild aquatic animal health situation with regard to these infectious diseases; 203.2. is emptied, cleaned, disinfected and kept unused for not less than six weeks; 203.3. items are renewed with the fish from the Latvian territory, zone or compartment, which related to the herpes disease koij is defined in the category I. 204. the territory of the country, zone or compartment, which related to the herpes disease koij is fixed in category V, class I may be obtained if all farms where the country, zone or compartment is kept in the susceptible aquaculture animal species, has implemented such a program: these provisions have been made for 204.1. Chapter VIII of the above control measures and eradication measures after an exotic infectious disease detection aquaculture animals and officially declared infected farms in the neighborhood have created a buffer zone This includes a protection zone and surveillance zone; 204.2. all the existing farms in the protection zone, keeping the susceptible aquaculture animal species that do not officially declared as infected with the herpes, conduct official koij investigations: 204.2.1. laboratory examinations take 10 samples of fish, if you have seen the herpes disease-specific koij clinical signs or post-mortem or 30 fish samples, if no clinical signs or post-mortem; 204.2.2. protection zone for the season, when the water temperature could have reached 15 ° C, monthly organized health checks and take samples for laboratory examinations pursuant to this provision, paragraph 3 of Annex 8; 204.3. all nurseries, which are officially declared to be infected with the herpes koij, emptied, cleansed, disinfected and uses at least six weeks. When all the same, the existing protection zone officially declared infected farms have been emptied, followed in no less than three weeks ' synchronize the inactivity period. After the end of the period of use of the protection zone into the surveillance zone. Service protection and created within the surveillance zone, where infectious diseases are monitored further outbreaks in other non-infected farms so far, you can also specify other emptying, emptying of farms, disinfection and fallowing. Do not use length of service determines the assessment of the risk of infection to the farm in each case separately, and this period is not less than six weeks; 204.4. all officially declared in the infected farms and all other protection and surveillance zones in existing farms that do not use the expired period, fish items restore in one of the following ways: 204.4.1. with the fish obtained from European Union Member States, zones or compartments, which related to the herpes disease koij is defined in the category I; 204.4.2. during the transition period up to 2020 December 31 – with fish from European Union Member States, zones or compartments, which is implemented in the European Commission approved the herpes disease koij monitoring program; 204.5. fish stocks have been restored only after all officially declared infected farms have been emptied, cleaned, and disinfected in accordance with this rule 204.3. section is over the non-use period; 204.6. all farms after the completion of the eradication program implemented the two-or four-year surveillance programme, which also apply to the sampling points in the population of wild aquatic animals, when part of the territory of Latvia or bivalve molluscs in farms farming area targeted monitoring does not provide enough data and epizootiological if aquatic animal populations in one or more animals of susceptible species. 205. The buffer zone shall be determined in each individual case of contamination, taking into account the risk factors that influence the spread of herpes koij nurseries fish and wild fish populations: 205.1. mortality (by number); 205.2. mortality rates and the breakdown by species and diseases with a herpes-infected farms koij; 205.3. distance to the neighborhood's farms and their placement in the density; 205.4. distance to the nearest slaughterhouse. 205.5. contact existing farms; 205.6. farms represented species; 205.7. infectious diseases in affected farms and neighborhood nurseries growing practices used; 205.8. hydrodynamic conditions; 205.9. other significant epizootiological factors. 206. When you create a protection zone and surveillance zone, subject to the following requirements: the geographical delimitation of 206.1. around officially declared infected farms, which found the herpes koij, shall establish a protection zone, corresponding to all the infected farms in the catchment area. Service area can be attributed only to the catchment areas, if it does not impair the prevalence of herpes koij prevention; 206.2. outside the protection zone established surveillance zone that corresponds to the enlarged area, covering up the protection zone. 207. Continental station, which consists of only one of the farm where the disease is of herpes koij canceled class I and in which the health situation does not affect the surrounding natural waters, you can restore a category I service, if the following conditions are met: 207.1. the Department is emptied, cleaned, disinfected and are over at least a six-week long inactivity period; 207.2. restore fish stocks with the fish, which come from the territory of the Latvian State, zone or compartment that is category I, or of the district in which the exercise of the herpes disease koij monitoring program (category II). 208. If I need to store the targeted surveillance in all farms where the relevant Latvian territory, zone or compartment is kept in the susceptible aquaculture animal species, organized health checks and take samples in accordance with Annex 8 B 2 of the requirements set out in the table, depending on the degree of risk for infection with a herpes koij. 209. Continental station, which regards the herpes disease koij is assigned to category I, determining the frequency of the health surveillance, taking into account the surrounding natural waters existing aquatic animal health situation in relation to that disease. In this district the health checks organised in accordance with the provisions of Annex 8 in table 2 C requirements which relate to the high level of risk. 210. If the Latvian territory, zone or compartment is a small farm and targeted monitoring does not provide enough epizootiological data to keep the category I, the program included in the sampling points in the population of wild aquatic animals. 211. Half of the rules referred to in paragraph 210 of sampling points each year. Sampling and laboratory investigations in accordance with the provisions of Annex 8 and table 2 C of this annex paragraph 1 and 2. 212. I saved until on all samples that tested pursuant to annex 8 of these rules 1 and 2 of the requirements referred to in paragraph 1, with negative results, and according to this provision, paragraph 3 of Annex 8 to exclude suspicion of herpes disease koij. 213. the territory of the country, zone or compartment to which the case of herpes disease koij is fixed in category V, category III may be obtained if: 213.1. these provisions have been complied with, 204.2.204.1 and in, as well as 204.3 205 and 206. the requirements referred to in point. If you do not use a period for technical reasons cannot be complied with, the relevant territory, zone or compartment shall implement any alternative measures that provide equivalent of the destruction of herpes koij nursery environment; 213.2. all officially declared in the infected farms and all other protection and surveillance zones in existing farms that do not use period has elapsed or alternative measures have been implemented in accordance with the provisions of section 212.1., the inventory is updated with fish from the Latvian territory, zone or compartment, which is category I, II or III for the herpes disease koij; 213.3. nursery stocks only after all officially declared infected farms have been emptied, cleaned, disinfected and is not the end of their period of use or alternative measures have been implemented in accordance with the provisions of section 213.1.. XX. Claim of infectious salmon anemia control and eradication program in order to obtain and maintain the health status of aquaculture animals "infectious disease" and limit contamination with pathogenic Isavir virus, which is not expressed in the genome polimorfisk (infectious salmon anemia without expressed polimorfisk (IPR)) 214. Infectious salmon anemia monitoring includes the following activities: 214.1. aquaculture and aquatic animal health General checks under this provision and paragraph 215.216; 214.2. specific aquaculture and aquatic animal health checks under this provision, and 218.217.219. point for category I; 214.3. aquaculture and aquatic animal health checks under this provision 220.221.222., and point to store category I; 214.4. aquaculture and aquatic animal health checks, according to paragraph 223 of these regulations, to cancel the containment measures and the Latvian territory, zone or compartment with respect to infectious salmon anemia (without IPRS) assigned to the category V could be assigned to category III. 215. in order to ensure the monitoring of infectious salmon anemia, diseases of aquaculture animals, general health check organized in the following order: 215.1. If ranching through targeted surveillance, health checks organized and sampled more often than once a year, long enough to determine the intervals between medical examination or taking of samples; 215.2. If you need a targeted population of wild aquatic animal health monitoring, the number of sampling points and the geographical distribution down to cover the national territory, zone or compartment. Sampling points representing the different ecosystems that contain susceptible populations of wild aquatic animals; 215.3. If health checks shall be carried out in units of production, such as ponds, tanks, cages, network, find out whether they are dead or weakened fish or fish with abnormal behavior. Special attention to the water outlet area where more weakened fish accumulate in streams. 216. The fish samples chosen: 216.1. having just a dying or dead, but not decayed fish. Prefer fish that show anemia, bleeding, or other clinical signs of circulatory disorders; 216.2. If sampling the site susceptible species include Atlantic salmon, Atlantic salmon is preferred. If farm Atlantic salmon, samples from other susceptible species; 216.3. If the cultivation of fish in using more than one water supply source, the sample included fish from all water sources; 216.4. fish samples taken to be represented proportionately in all nursery production units – such as ponds, tanks, network, as well as all cages of fish vecumgrup. 217. the territory of the country, zone or compartment with respect to infectious salmon anemia (without IPRS) is defined in the class III category I can find, if all farms where the relevant Latvian territory, zone or compartment is kept in the susceptible aquaculture animal species, these provisions meet the requirements of chapter XIII and if they, as well as sample points in the population of wild aquatic animals have implemented such a monitoring program : 217.1. for two consecutive years is carried out health checks and take samples, as specified in annex 9 of this rule 3 A table; 217.2. two-year surveillance programme in all samples during laboratory studies with this provision 9.3, 4 and 5 set out in diagnostic methods for IP (without IPRS) have produced negative results, and excluded any suspicion of infectious salmon anemia in implementing the provisions of paragraph 6 of Annex 9 in the diagnostic procedures; 217.3. If monitoring during the implementation of the programme in which the farm is approved for infectious salmon anemia and category II is cancelled, shall implement the programme in accordance with this provision and paragraph 218.219. 218. the Government of the territory, zone or compartment with respect to infectious salmon anemia (without IPRS) have a certain category V, class I may be obtained if the nationwide national territory, zone or compartment in existing farms, keeping the susceptible aquaculture animal species, has implemented such a program: these provisions have been made for 218.1. a referred to in chapter VI controls and control measures after the exotic infectious diseases of aquaculture animals, and captures their farm neighborhood , which officially declared as contaminated with infectious salmon anemia (without IPRS) or where the infectious salmon anemia approved presence, established a buffer zone that includes the protection zone and the surveillance zone; 218.2. a buffer zone established in each of the cases separately, taking into account the risk factors that affect infectious salmon anemia spread of fish farms or in the wild fish populations: 218.2.1 of infectious salmon anemia with (without IPRS) genotype with the infectious salmon anemia virus-infected or confirmed infectious salmon anaemia, sick of fish mortality (by number), mortality and the breakdown by species and diseases infected farms; 218.2.2. the distance to the neighborhood's farms and their placement in the density; 218.2.3. the distance to the nearest recycling companies; 218.2.4. contact existing farms; 218.2.5. farms represented species; 218.2.6. infectious diseases in affected farms and nurseries in the vicinity used cultivation practice; 218.2.7. hydrodynamic conditions and other important factors of epizootiological; 218.3. in the protection zone and the surveillance zone shall comply with the following requirements: the geographical delimitation of 218.3.1. around the officially declared infected farms, which found the infectious salmon anemia, shall establish a protection zone that coastal areas meet the circle enclosed area, which is one of the tidal RADIUS bandwidth or five kilometres (uses the largest value) with the center of the farm, or an equivalent area determined on the basis of hydrodynamic or epizootiological data. Inland it is the whole catchment area, which corresponds to the farm, which was officially declared to be infected with infectious salmon anaemia. Service protection zone can be attributed only to the catchment areas, if it is not reduced the prevalence of infectious salmon anaemia control; 218.3.2. around the protection zone of the surveillance zone in coastal areas meet the circle enclosed territory, in which experiencing tidal bar area of overlap, or protection zone territory in full in a circle whose RADIUS is 10 kilometers from the center of the protection zone or an equivalent area determined on the basis of hydrodynamic or epizootiological data. Inland it is extended area outside the established protection zone; 218.4. protection zone in existing farms, keeping the susceptible aquaculture animal species that do not officially declared as contaminated with infectious salmon anemia, carry out official investigations: 218.4.1. at least 10 dying fish samples for laboratory examinations, if the infectious salmon anemia observed in specific clinical or post-mortem signs, or at least 30 fish samples for laboratory examinations, if clinical signs or post-mortem are not observed; 218.4.2. to the protection zone for a farm where these rules referred to in paragraph 218.4.1 in laboratory studies have produced negative results, organizes a monthly health check; 218.5. all nurseries, which are officially declared as contaminated with infectious salmon anemia (without IPRS) or where the infectious salmon anemia approved the presence of empties, cleansed, disinfected and, in not less than three months long inactivity period. When all farms within the protection zone is emptied, cleaned, disinfected and is over no less than six weeks long in-sync without periods, requirements for the protection zone and the surveillance zone can be cancelled; 218.6. the end of the period of use of the officially declared infected farms within the protection zone into the surveillance zone; 218.7. service protection and created within the surveillance zone, where infectious diseases are monitored further outbreaks in other non-infected farms so far, you can also specify other nurseries, emptying the cleaning, disinfection and fallowing. Do not use length of service laid down in these farms, the evaluation of the risk of infection to the farm in each individual case, but do not use period is not less than three months; 218.8. nurseries, which are officially declared as contaminated with the infectious salmon anemia virus with genotype of infectious salmon anaemia (without IPRS) or where the infectious salmon anemia approved presence, and all other areas in the protection and surveillance zones in existing farms that do not use the expired period, renew fish stocks resulting from the Latvian territory, zone or compartment to which certain category I in relation to infectious salmon anemia; 218.9. fish stocks recover after all officially declared infected farms have been emptied, cleaned, disinfected and is not the end of their period of use; 218.10. all farms and, if necessary, monitoring the population of wild aquatic animals, including sample points designated in accordance with the provisions of paragraph 215, after the completion of the eradication program implemented the provisions referred to in paragraph 217 of the surveillance program. 219. Continental station, which consists of only one of the farm where the health situation does not affect the surrounding natural waters and in accordance with the provisions of paragraph 101 class I is repealed in respect of infectious salmon anemia, you can restore it, if the following conditions are met: 219.1. compartment is empty, cleaned, disinfected and is over no less than six weeks long inactivity period; 219.2. station items have been restored with the fish from the Latvian territory, zone or compartment in which in respect of infectious salmon anemia is defined in the category I. 220. If I need to store the targeted surveillance in all farms that Latvian territory, zone or compartment is kept in the susceptible aquaculture animal species, organized health checks and take samples of fish, as defined in this provision 9. table 3 B, depending on the risk for contamination with infectious salmon anemia. 221. The station, having a certain category I and located in the continental area, the risk of being infected with infectious salmon anaemia considered high if the medical condition in respect of infectious salmon anaemia in this station depends on the health status of the surrounding natural waters where the Atlantic salmon (Salmo salar). This assessment takes into account, in these precincts, determining the health checks. 222. with regard to category I infectious salmon anemia saves until the all the samples that were tested using this rule 9.3, 4 and 5 in diagnostic methods for infectious salmon anemia virus with genotype of infectious salmon anaemia (without IPRS) have produced negative results, and excluded any suspicion of infectious salmon anemia that rule 9, paragraph 6 of the annex. 223. the territory of the country, zone or compartment that relating to infectious salmon anemia have a certain category V, category III may be obtained if: 223.1. these provisions have been complied with, 218.2, 218.1..., 218.4 218.3., 218.5, 218.6. and 218.7. the requirements referred to in point. If for technical reasons it is not possible to comply with the non-use period, territory, zone or compartment in existing farms implement any alternative measures that provide equivalent of infectious salmon anemia virus destruction of nursery environment; 223.2. officially declared in the infected farms and all the other farms in the established protection and surveillance zones, which have not ended the period of use or alternative measures have been implemented in accordance with the provisions of subparagraph, item 223.1 have been restored with the fish obtained in the territory of the Latvian State, zone or compartment, a category I, II or III for infectious salmon anemia; 223.3. fish stocks have been restored only after all officially declared infected farms have been emptied, cleaned, disinfected and inactivity period has expired or the implementation of alternative measures in accordance with the provisions of section 223.1.; 223.4. two years, 223.2 and 223.3 223.1... the implementation of the measures referred to in these farms have confirmed infectious salmon anemia virus with genotype of infectious salmon anaemia (without IPRS) and suspected have been excluded the provisions of Annex 9, paragraph 6. XXII. marteiliosis (Marteilia refringens) surveillance and eradication program in order to obtain and maintain the health status of aquaculture animals "infectious disease" and limit infection with Marteilia refringens 224. monitoring marteiliosis includes the following activities: 224.1. mussels for general health checks under this 225. the provisions and paragraph 226; 224.2. clams-specific health checks under this provision 227.228, 229, 230, 231.., 232, 233, 234, 235.., 236 and 237. point. for category I-health "infectious disease"; 224.3. shellfish health checks under that rule 238.239. point and to keep the category I-health "infectious disease"; 224.4. shellfish health checks under this provision in paragraph 240, to cancel the containment measures and the territory of the Republic of Latvia, or compartment to which the zone for assigned category V marteiliosis, could be assigned to category III. 225. the health inspection organized and take samples for laboratory examinations season when Marteilia refringens among Latvian territory, zone or compartment is the maximum. If such a message is not a, after sampling the water temperature has exceeded 17 ° C. 226. Shellfish Health samples taken according to the following criteria: 226.1. If the production units or production area is located in Ostrea spp. or Mytilus spp., from the two genera in volume equal to take samples. If you have only one of these genera, samples shall be taken from them. If there are no representatives of that genus, composed of samples from all other represented the susceptible species; 226.2. If found in a weakened, curled or recently dead, but does not split the molluscs collected recently dead mussels. If the mussels are not sampling older, healthy scallops; 226.3 of shellfish farming zones, which use more than one source of water, all the water taken from shellfish sources so that the sample is proportional to the representation of all parts of the production area; 226.4. shellfish farming area of bivalve molluscs from an adequate number of sampling points to be collected in a sample is proportional to the representation of all shellfish growing area. Sampling points shall be selected from those points which show Marteilia refringens, as well as depending on population density, water flows, the presence of susceptible species, infectious disease pārnesējsug (hereinafter referred to as the vektorsug), the presence of bathymetry data and cultivation practices. The samples are also collected in natural channels. 227. the territory of the country, zone or compartment with regard to infections with Marteilia refringens is defined in the class III category I can find, if all shellfish farming areas in the territory of the country, zone or compartment is kept in the susceptible aquaculture animal species, monitoring programme have been implemented. 228. in implementing the two-year surveillance program: 228.1. shellfish farming zones organized health checks and take samples in accordance with the provisions of annex 10 4 A table. If the sample includes Ostrea edulis, Mytilus edulis Mytilus galloprovincialis, or obtained in the territory of the Latvian State, zone or compartment, category I of its shellfish growing area is neglected not later than the spring, just before the start of the monitoring programme; 228.2. all samples for laboratory examinations used in this provision, paragraph 2, of annex 10 contains the diagnostic methods to this provision, annex 10, paragraph 3 of the order off any suspicion of Marteilia refringens. 229. the territory of the country, zone or compartment with regard to infections with Marteilia refringens is fixed in category V, class I may be obtained if all shellfish farming zones in which the Latvian territory, zone or compartment of susceptible species are kept, these provisions have been implemented within Chapter VI control and eradication measures and shellfish farming area neighborhood, which officially declared infected with Marteilia refringens the buffer zone has been established, which includes the protection zone and the surveillance zone. 230. The buffer zone shall be determined in each individual case of contamination, taking into account the risk factors affecting Marteilia refringens spread: 230.1. with Marteilia refringens infected shellfish growing area shellfish, clams, wild also mortality (by number); 230.2. the mortality of bivalve molluscs (by age), mortality and the breakdown by species and diseases infected farms; 230.3. shellfish farming zones distance to the neighborhood's shellfish growing areas and their placement in the density, as well as shellfish growing area can be found in the wild species of bivalve molluscs; 230.4. distance to the nearest processing plant; 230.5. distance to contact existing shellfish growing areas; 230.6. animals of susceptible species and the presence of vektorsug shellfish farming area; 230.7. infectious diseases in affected shellfish production zones and their vicinity; 230.8. bivalve mollusc production used in zone practices; 230.9. hydrodynamic conditions; 230.10. other significant epizootiological factors. 231. Protection Zone and surveillance zone established in the following order: 231.1. around officially declared infected shellfish farming area, which found the Marteilia refringens, shall establish a protection zone, corresponding to the territory, which is determined on the basis of the hydrodynamic or epizootiological data; 231.2. around the protection zone established a surveillance zone, corresponding to the territory, which is determined on the basis of the hydrodynamic or epizootiological data. 232. in implementing the program: 232.1. protection zone existing shellfish growing area, which are kept in the susceptible aquaculture animal species and which is not officially declared infected with Marteilia refringens, conduct official investigation after Marteilia refringens prevalence period start taking samples for laboratory examinations of molluscs 150. If Marteilia refringens prevalence period is not known, start to take samples of the season, when the water temperature has exceeded 17 ° C; 232.2. all officially declared infected shellfish farming areas empty, if possible, cleaned, disinfected, and observe their non-use period: 232.2.1. not less than two months, if shellfish farming area is limited with waters containing eggs incubator and nursery farms; 232.2.2. not less than two months, if shellfish farming area is not limited with the surrounding waters and the animals of susceptible species infected clams and the mussels of susceptible species that is related to the epizootiological infected shellfish farming area is harvested or removed before the maximum Marteilia refringens prevalence period or, if this is not known, the season when the water temperature exceeds 17 ° C; 232.2.3. not less than 14 months if shellfish growing area is not limited with the surrounding waters and the animals of susceptible species infected clams and the mussels of susceptible species that is related to the epizootiological infected shellfish growing area, not harvested or removed before the maximum Marteilia refringens prevalence period or, if this is not known, the season when the water temperature exceeds 17 ° C. 233. when all officially declared infected shellfish farming zones have been emptied, followed four weeks of inactivity period synchronized. 234. the service protection and created within the surveillance zone to existing shellfish growing areas, taking into account the risk of spreading infectious diseases, as well as that of the infected shellfish farming zones has been the movement of the shellfish, you can also specify other shellfish farming area, emptying the cleaning, disinfection and fallowing, where the epizootiological inquiry has led to the importation of bivalve molluscs found infected shellfish growing areas. Do not use length of service determines the assessment of the risk of infection in each individual case, but it may not be longer than four weeks. 235. in All officially declared infected shellfish growing areas and in all other places located in the established protection and surveillance zones, if the period of use, not the items restored to bivalve molluscs obtained in the territory of the Latvian State, zone or compartment, category I, relating to infections with Marteilia refringens. 236. Shellfish stocks renewed only after all officially declared infected shellfish farming zones in accordance with 232.2. this rule and section is emptied of 294.3., cleaned, disinfected and is not the end of their period of use. 237. All molluscs farming areas program in the State of the territory, zone or compartment of susceptible species are kept, after the completion of the eradication measures implemented this provision in paragraph 63 of the surveillance program. 238. Category I-health "infectious disease": If the exercise targeted surveillance, all shellfish farming zones that Latvian territory, zone or compartment there susceptible aquaculture animal species, organized health checks, depending on the level of risk of contamination of bivalve mollusc farming area and sampling, as specified in annex 10 of this rule 4 (B) of the table. 239. I saved until the all the samples that were tested, using the rules of paragraph 2 of annex 10 contains the diagnostic methods for Marteilia refringens has produced negative results and that rule 10, paragraph 3 of the annex in the order excluded any suspicion of Marteilia refringens. 240. the territory of the country, zone or compartment with regard to infections with Marteilia refringens is fixed in category V, category III may be obtained if: 240.1. these provisions have been complied with, 230.229.231, 232, 233,. a. and in paragraph 234. If for technical reasons it is not possible to comply with the non-use period, the territory of the Latvian State, zone or compartment within an existing shellfish growing area implemented an alternative measure which provides equivalent Marteilia refringens destruction of the environment; 240.2. officially declared infected in shellfish farming areas and in all other places in the protection and surveillance zones and is not the end of their period of use or alternative measures have been implemented in accordance with the provisions of subparagraph, item 240.1 have been restored with bivalve molluscs obtained in the territory of the Latvian State, zone or compartment with regard to infections with Marteilia refringens of a certain category I, II or III; 240.3. shellfish stocks only after all officially declared infected shellfish farming zones have been emptied, cleaned, disinfected and is not the end of their period of use or alternative measures have been implemented in accordance with the provisions of section 240.1.; 240.4. two years after this provision 240.1., 240.2. and 240.3. implementation of the measures referred to are not confirmed infection with Marteilia refringens and that rule 10 in paragraph 3 of the annex in the order excluded the suspected contamination. XXIII. the requirements bonamiosis (Bonamia ostreae) surveillance and eradication program in order to obtain and maintain the health status of aquaculture animals "infectious disease" and limit infection with Bonamia ostreae 241. supervision of bonamiosis includes the following activities: shellfish 241.1. General health checks under this provision and paragraph 242.243; 241.2. clams-specific health checks under this provision 244.245, 246, 247, 248, 249, the., 250, 251, 252.., 253.254. point, and for class I-medical condition "infectious disease"; 241.3. shellfish health checks under this provision, 256 and 257 255..., to keep the category I-health "infectious disease". 242. the health of bivalve molluscs general inspection organized and samples at the season when the distribution of Bonamia ostreae Latvian territory, zone or compartment is the maximum. If Bonamia ostreae is not known, the prevalence of samples in winter or in early spring. 243. Shellfish Health samples taken according to the following criteria: 243.1. where is Ostrea edulis, only this species sampled mussels. If not, Ostrea edulis consists of samples from all other represented the susceptible species; 243.2. If found in a weakened, curled or died, but does not split the molluscs collected recently dead mussels. If the mussels are not sampling older, healthier bivalve molluscs; from 243.3. shellfish farming zones, which use more than one source of water, all the water taken from shellfish sources so that the sample is proportional to the representation of all shellfish growing area; 243.4. shellfish farming area of bivalve molluscs collected from a sufficient number of sampling points. Sampling points shall be selected from those points, which found the Bonamia ostreae, as well as depending on population density, water flow, the presence of susceptible species, the presence of vektorsug, bathymetry data and cultivation practices. Samples are also collected in adjacent natural beds. 244. the territory of the country, zone or compartment, with regard to Bonamia ostreae is III category, category I can get if all shellfish farming zones in which the Latvian territory, zone or compartment of susceptible species are kept, shall implement a monitoring program. 245. in implementing the two-year surveillance program: 245.1. shellfish farming zones organized health checks and sampling, as defined in this provision 9. table 5 (A). If the sample includes Ostrea edulis, obtained in the territory of the Latvian State, zone or compartment, category I of its shellfish growing area is neglected not later than autumn, just before the start of the monitoring programme; 245.2. all laboratory examinations of the samples used in this provision, paragraph 2, of annex 11 contains diagnostic methods, to this annex the provisions in paragraph 3 of the order off any suspicion of Bonamia ostreae. 246. the territory of the country, zone or compartment with respect to infection with Bonamia ostreae is a definite category V, class I may be obtained if all shellfish farming zones in which the Latvian territory, zone or compartment of susceptible species are kept, is implemented in the program and these rules within Chapter VI controls and control measures after the exotic infectious diseases of aquaculture animals, establishing as well as shellfish growing area neighborhoods that officially declared infected with Bonamia ostreae, established a buffer zone that includes the protection zone and the surveillance zone. 247. The buffer zone shall be determined in each individual case of contamination, taking into account the risk factors affecting the Bonamia ostreae spread: 247.1. with Bonamia ostreae infected shellfish growing area of wild shellfish of bivalve molluscs, also, mortality, mortality rates, by number, description and breakdown by age and disease in the infected farm; 247.2. distance to the neighborhood's shellfish growing areas and their placement in the density, as well as shellfish growing area can be found in the wild species of bivalve molluscs; 247.3. distance to the nearest processing plant; 247.4. distance to contact existing shellfish growing areas; 247.5. animals of susceptible species and the presence of vektorsug shellfish farming area; 247.6. Bonamia ostreae affected shellfish farming zones and their vicinity shellfish farming zones used in cultivation practice; 247.7. hydrodynamic conditions; other significant 247.8 epizootiological factors. 248. Protection Zone and surveillance zone established in the following order: 248.1. around officially declared infected shellfish growing area, which identified Bonamia ostreae, shall establish a protection zone, corresponding to the territory, which is determined on the basis of hydrodynamic or epizootiological data; 248.2. around the protection zone established a surveillance zone, corresponding to the territory, which is determined on the basis of hydrodynamic or epizootiological data. 249. The protection of the existing shellfish growing zone where susceptible species are kept and which has not been officially declared infected with Bonamia ostreae, carry out official investigations by Bonamia ostreae prevalence period start taking samples of 150 species of bivalve molluscs susceptible laboratory examinations. If Bonamia ostreae prevalence period is not known, start to take samples in the winter or in early spring. 250. all officially declared infected shellfish growing area, which identified Bonamia ostreae, emptied, if possible, cleaned, disinfected, and followed six months of non-use period. 251. when all officially declared infected shellfish farming zones have been emptied, followed four weeks of inactivity period synchronized. 252. the Department established protection and surveillance zones or shellfish growing areas may require other shellfish farming area, emptying the cleaning, disinfection and fallowing. Do not use length of service determines the assessment of the risk of infection in each case separately. 253. in All officially declared infected shellfish growing areas and in all other places located in the established protection and surveillance zones, if the period of use, not the items restored to bivalve molluscs obtained in the territory of the Latvian State, zone or compartment, a category I for infection with Bonamia ostreae. Items are renewed only after all officially declared infected shellfish farming zones in accordance with this provision, and 251.250.252. point is emptied, cleaned, disinfected and is not the end of their period of use. 254. All molluscs farming areas program in the State of the territory, zone or compartment of susceptible species are kept, after the completion of the eradication measures implemented this provision 244.245. and above the surveillance program. 255. If (I) the conservation category for infection with Bonamia ostreae targeted monitoring is required, all shellfish farming zones in which the Latvian territory, zone or compartment of susceptible species are kept, shall organise the health check on the level of risk for infection with Bonamia ostreae and sampling, as defined in annex 11 of this rule 5 (B) of the table. 256. I saved until the all the samples that were tested using this provision, paragraph 2, of annex 11 contains diagnostic methods, with regard to Bonamia ostreae with negative results and that rule 11, paragraph 3 of the annex in the order excluded any suspicion of Bonamia ostreae. 257. the territory of the country, zone or compartment with respect to infection with Bonamia ostreae is a definite category V, category III may be obtained if: 257.1. these provisions have been complied with, 247.246.248, 249, 250, 251, 252,. a. and in paragraph 253 of the requirements set. If for technical reasons it is not possible to comply with the non-use period, the territory of the Latvian State, zone or compartment within an existing shellfish growing area implemented an alternative measure which provides equivalent effect Bonamia ostreae disposal area; 257.2. officially declared infected in shellfish farming areas and in all other places that are established in the protection and surveillance zones and is the end of their period of use or not in accordance with the provisions of section 257.1. alternative measures have been implemented, the inventory is updated with bivalve molluscs obtained in the territory of the Latvian State, zone or compartment with respect to infection with Bonamia ostreae of a certain category I, II or III; shellfish stocks 257.3. only After all officially declared infected shellfish farming zones have been emptied, cleaned, disinfected and is not the end of their period of use or alternative measures have been implemented in accordance with the provisions of section 257.1.; 257.4. two years., 257.2. and 257.3 257.1. referred to the implementation not confirmed infection with Bonamia ostreae and annex 11 of these rules of procedure laid down in paragraph 3, the off any suspicion about contamination. XXIV. the requirements of baltplankum of cancer disease monitoring and eradication program in order to obtain and maintain the health status of aquaculture animals "infectious disease" and limit contamination with baltplankum syndrome virus 1.258. Cancer of the baltplankum type of disease monitoring includes the following activities: 258.1. crustaceans general health checks under this provision, 259.260.261 and 262, paragraph; a. 258.2. crustaceans specific health checks under this rule 263.264, 265, 266, 267, 268, the., 269, 270, 271.., 272, 273, 274.., 275 and 276, paragraph. for category I-health "infectious disease"; 258.3. shellfish health checks under this provision 277.278, 279, 280, paragraph, and to keep the category I-health "infectious disease"; 258.4. shellfish health checks under this provision in paragraph 281, to cancel the containment measures and the territory of the Republic of Latvia, or station, having regard to the baltplankum cancer disease specific category V could be assigned to category III. 259. Crustaceans general health check organised and take samples for laboratory examinations when could be reached a year high water temperature. 260. In farms sampled according to crustacean following criteria: 260.1. If the production units is weakened or dying crustaceans, having weakened to crustaceans. If not, this crustacean sampled near the susceptible species belonging to the selected and proportional representation of the different sizes of crustaceans, both young and adult individuals; 260.2. If the crustaceans for farming uses more than one water source, samples are taken from all water sources. 261. If in accordance with this rule 103.3. subparagraph requires targeted surveillance in wild aquatic animals in the population, the number of sampling points and the geographical distribution determines it to be covered in the Latvian territory, zone or compartment. Sampling points representing the different ecosystems, sea, estuary, River and Lake system, in which the wild aquatic animals of susceptible species populations. 262. If in accordance with this rule 103.2. subparagraph requires targeted surveillance in wild aquatic animals population, crustaceans shall be designated as follows: sample 262.1. Marine and estuarine system in the territory shall designate one or more of the following species of maen, Carcin-Cancer Pagurus, Eriocheir sinensis, Liocarcin, Liocarcin of the depurator puber, Crangon Crangon, Homar in amphipods, Palaemon adspers, or species of Penaeidae, such as Penaeus japonica, Penaeus kerathurus, Penaeus semisulcat. If not, these species are represented in the sample in desmitkājvēž other susceptible species. Whereas animals of susceptible host range is extensive, you can select from the desmitkājvēž genus or family, which is experimental or susceptibility of naturally proven; 262.2. River and Lake systems shall designate one or more of the species as Pacifastac in leniuscul, leptodactyl, Austropotamobi in the Astac pallip or Orconectes Limosa. If not, these species are represented in the sample in desmitkājvēž other susceptible species. Whereas animals of susceptible host range is extensive, you can select from the desmitkājvēž genus or family, which is experimental or susceptibility of naturally proven; 262.3. If in the middle of crustaceans is weakened or dying, having weakened the crustacean vēzveidīgo. If not, this crustacean sampled near the susceptible species belonging to the selected and proportional representation of the different sizes of crustaceans, both young and adult individuals. 263. the territory of the country, zone or compartment with regard to cancer in baltplankum disease is a category III category I can get, if the Latvian territory, zone or compartment existing nurseries where susceptible species are kept: 263.1. these provisions meet the requirements contained in chapter XIV; 263.2. According to this provision, section 103.3. implement a two-year surveillance programme, which also apply to the sampling points in the population of wild aquatic animals (if necessary). 264. in the implementation of the monitoring programme, farms or sample points for two consecutive years: 264.1. organized health checks and sampling, as defined in this provision of the annex 6a 12 table; 264.2. laboratory examinations used this provision in paragraph 2 of annex 10 contains the diagnostic method to this provision, annex 10, paragraph 3 of the order off any suspicion of cancer diseases of baltplankum. 265. If monitoring during the implementation of the programme in one of the farms have confirmed infection with the virus baltplankum syndrome type 1 and class II cancelled the farm, farm it can recover and continue monitoring the implementation of the programme, for category I, not implementing the provisions referred to in paragraph 266 of the eradication programme if: it is the continental farm 265.1. where the health status regarding cancer diseases of baltplankum in accordance with this rule 110. 111, 112, 113, 114., 115, 116, 117, 118, 119 and 120 a... "the point is independent of the health status of the surrounding natural waters; 265.2. farm is emptied, cleaned, disinfected and is over no less than six weeks long inactivity period; 265.3. nursery stock is renewed with crustaceans, obtained in the territory of Latvia in the zone or compartment, having regard to the baltplankum cancer disease is defined in the category I. 266. the Government of the territory, zone or compartment with regard to cancer in baltplankum disease is a specific category V, class I may be obtained if all the relevant Latvian territory, zone or compartment in existing farms where susceptible species are kept, is implemented in the program, follow this rule listed in Chapter VII control and eradication measures and the the neighborhood, which officially declared infected with cancer in baltplankum disease, established a buffer zone that includes the protection zone and the surveillance zone. 267. The buffer zone shall be determined in each individual case of contamination, taking into account the risk factors that influence cancer baltplankum of the spread of the disease and wild crustaceans: cancer of the baltplankum of 267.1. disease infected farms by number of crustaceans mortality rates, mortality rates and the breakdown by species and diseases infected farms; 267.2. distance to the neighborhood's farms and their placement in the density; 267.3. contact existing farms; 267.4. farms represented species; 267.5. affected the vicinity in farms and farms use growing practices; 267.6. hydrodynamic conditions; 267.7. other significant epizootiological factors. 268. the protection zone and surveillance zone established in the following order: 268.1. around officially declared infected farms, which found the cancer of baltplankum disease, shall establish a protection zone: 268.1.1. Marine and estuarine areas, enclosed in a circle, the radius of which correspond to one of the tides or the bandwidth is five kilometers (uses the largest value) with the center of the farm, or an equivalent area determined on the basis of hydrodynamic or epizootiological data; 268.1.2. fresh – all catchment areas, which correspond to the farm, which is officially declared to be infected with the cancer of baltplankum disease. Service protection zone may be restricted by catchment area, if it is not reduced to baltplankum of cancer disease prevention; 268.2. around the protection zone established surveillance zone: 268.2.1. marine area – the area in which the observed tidal bar area, or circle of a territory, delimited a 10-kilometre radius from the Centre of the protection zone, or an equivalent area determined on the basis of hydrodynamic or epizootiological data; 268.2.2. fresh-extended area outside the established protection zone. 269. The protection of a farm where the susceptible species are kept and which is not officially declared infected with cancer in baltplankum disease, conduct official investigation: 269.1. laboratory examinations take 10 samples of crustaceans when clinical or post mortem is observed for baltplankum disease of cancer characteristics, or 150 samples of crustaceans, where such clinical signs or post-mortem are not observed; 269.2. to cancel the protection zone in accordance with this provision, 270 271 272 points and ranching in which this provision is referred to in section 269.1. in laboratory studies have produced negative results, organizes a monthly health check. 270. all officially declared infected farms, which found the cancer of baltplankum disease, emptied, cleaned, disinfected and not less than six weeks long inactivity period. When all of the officially declared infected farms have been emptied, followed in no less than three weeks ' synchronized inactivity period. 271. when the officially declared infected in nurseries has passed non-use period, the protection zone into the surveillance zone. 272. the Department established in the protection and surveillance zones can be requested to empty, cleaned, disinfected, and don't use the other nurseries. Do not use length of service determines the assessment of the risk of infection in each case separately. 273. in officially declared infected farms and all farms situated in the established protection and surveillance zones, after a period of use the items restored in one of the following ways: 273.1. crustaceans obtained by the Latvian territory, zone or compartment with regard to cancer in baltplankum disease is a specific category I; 273.2. during the transition period up to 2020 December 31 – with the crustaceans from the Latvian territory, zone or compartment, which implement an approved cancer baltplankum of disease surveillance program. 274. Crustaceans stocks renewed only after all officially declared infected farms, which found cancer baltplankum of disease, in accordance with this rule, 271 and 272 270. point is emptied, cleaned, disinfected and is not the end of their period of use. 275. All farms where eradication programme in Latvia of the territory, zone or compartment of susceptible species are kept, and, if necessary, monitoring the population of wild aquatic animals, also sampling points chosen in accordance with this rule 103.2., after the completion of the eradication programme implemented this provision in paragraph 263 and 264 of this monitoring program. 276. Continental station, which consists of only one of the farm where the health status regarding cancer of the baltplankum disease in accordance with the provisions of article 110, 111, 112, 113, 114., 115, 116, 117, 118, 119 and 120 a... don't affect the surrounding natural waters and which category I is cancelled, you can restore it, if the following conditions are met: 276.1. farm is emptied, cleaned, disinfected and is over no less than six weeks long inactivity period; 276.2. nursery stock is renewed with crustaceans, obtained in the territory of Latvia in the zone or compartment, having regard to the baltplankum cancer disease is defined in the category I. 277. If I need to store the targeted surveillance in all farms where the relevant Latvian territory, zone or compartment of susceptible species are kept, organised by the health check, depending on the degree of risk for infection with cancer baltplankum of disease and sampling, as defined in this provision of the annex 6B 12. table. 278. If the Latvian territory, zone or compartment not much and it targeted the farm monitoring does not provide enough epizootiological data to get and keep the category, I also implemented the monitoring programme sampling points chosen in accordance with this provision and paragraph 261.262. 279. each year, the change in the direction of this provision in paragraph 280 of the sampling point. Samples shall be taken as laid down in annex 12 of these rules in table B, and 6 of these regulations shall investigate the laboratory 12. in accordance with the procedure laid down in the annex. 280. Category I saved until the all the samples that were tested using this provision 12.2 and 3 of the annex mentioned under diagnostic methods have produced negative results, and 12 of these rules. in paragraph 4 of the annex, in accordance with the procedure laid down in any suspicion of cancer diseases of baltplankum. 281. the territory of the country, zone or compartment with regard to cancer in baltplankum disease is a specific category V, category III may be obtained if: 281.1. these provisions have been complied with, 266.267, 268, 269.., 270, 271 and 272.. the requirements referred to in paragraph 1. If for technical reasons it is not possible to comply with the non-use period, Latvian territory, zone or compartment to the existing farm implement any alternative measures that provide equivalent baltplankum syndrome type 1 virus destruction of nursery environment; 281.2. officially declared in the infected farms and all the other farms in the established protection and surveillance zones and over the period of use or not in accordance with the provisions of section 281.1. alternative measures have been implemented, the inventory is updated with crustaceans, obtained in the territory of Latvia in the zone or compartment, a category I, II or III for cancer baltplankum of disease; 281.3. stocks revived after all officially declared infected farms have been emptied, cleaned, disinfected, and the end of their period of use or not in accordance with the provisions of section 281.1. implementation of alternative measures; 281.4. two years after this provision 281.1. and 281.2. the implementation of the measures referred to in point baltplankum of the disease of cancer is not found and that rule 12, paragraph 4 of the annex in the order are excluded any suspicion about it. XXV. In closing the issue of 282. Void lost in the Cabinet of Ministers of 2 June 2008. Regulation No 400 ' health requirements for aquaculture animals and products derived therefrom, as well as the movement of aquaculture animals of infectious disease prevention and eradication "(Latvian journal, 2008, no. 88, no. 166, 2009; 23; by 2014, 2013, 113. no). Informative reference to European Union directives, the regulations include provisions resulting from: 1) of the Council of 24 October 2006 of Directive 2006/88/EC for aquaculture animals and products thereof animal health requirements, as well as on the prevention and control of certain diseases in aquatic animals; 2) Commission of 30 April Directive 2008/53/EC, amending Council Directive 2006/88/EC annex IV concerning Spring Viremia of carp; 3) Commission of 25 October 2012, the implementation of the Directive in 2012/31/EU, amending Council Directive 2006/88/EC annex IV for the list of fish species that are susceptible to the viral haemorrhagic septicaemia, and record of epizootic ulcerative syndrome of deletion; 4) Commission 2014 13. Implementing directives of February 2014/22/EU, amending Council Directive 2006/88/EC annex IV in respect of infectious salmon anaemia. Prime Minister-Minister of agriculture John Dūklav Interior Minister Richard Kozlovsk of annex 1 of the Cabinet of Ministers of 14 March 2017 regulations No 146 aquaculture animal infectious diseases i. exotic infectious diseases No. PO box Infectious disease susceptible aquaculture animal species the name of the Latvian language and Latin fish infectious diseases 1. Epizootic haematopoietic necrosis in rainbow trout (Oncorhynchus mykiss), perch (Perca fluviatilis) bivalve molluscs infectious diseases 2. Bonamioz-Australian mud oyster (Ostrea angas), Chilean flat oyster (Oster-chilens) 3. The Royal Perkinsoz Pacific oyster (Crassostrea gigas), the Eastern oyster (Crassostrea virginica) 4. The Royal Mikrocitoz Pacific oyster (Crassostrea gigas), the Eastern oyster (Crassostrea virginica), Olympia flat oyster (Ostrea conchaphil), the European flat or real (natural) oyster (Ostrea edulis) crustaceans infectious disease 5. Horn syndrome Atlantic white shrimp (Penaeus setifer), blue shrimp (Penaeus stylirostr), white shrimp (Penaeus vannam) 6. Yellow head disease Northern brown shrimp (Penaeus aztec) Northern pink shrimp (Penaeus duorar), the shrimp at Kuruma (Penaeus japonica), large (Penaeus monodon) tīģergarnel, Atlantic white shrimp (Penaeus setifer), blue shrimp (Penaeus stylirostr), white shrimp (Penaeus vannam) (II). no exotic infectious diseases No. PO box Infectious disease susceptible aquaculture animal species the name of the Latvian language and Latin fish infectious diseases 7. Viral haemorrhagic septicaemia genus of herring (Clupea spp.), the genus of Whitefish (Coregonus sp.), Pike (Esox Lucio), haddock (Year aeglefinus), Pacific cod (macrocephalus), Atlantic cod (Gadus morhua), Pacific salmon (Oncorhynchus spp.), rainbow trout (Oncorhynchus mykiss), in marine moustaches forkbeard (Mustela of strengthened interaction), sea trout (Salmo trutta), turbot (Scophtalm Maximus), sprat (sprattus sprattus), flounder (a Paralichthy olivaceus) 8. Infectious haematopoietic necrosis Ketlas (Oncorhynchus cat), Coho salmon (Oncorhynchus kisutch), far East salmon (Oncorhynchus maso), rainbow trout (Oncorhynchus mykiss), nerka (Oncorhynchus nerka), Amagi of salmon (Oncorhynchus rhodur), Cavic (Oncorhynchus tshawytsch), Atlantic salmon (Salmo salar) 9. Koi Herpes Virus Sazān (for Cyprin carpi) 10. Infectious salmon anemia, infection by pathogenic Isavir virus, which is not expressed in the genome of polimorfisk region (infectious salmon anemia without expressed polimorfisk region or PROVINCE (without IPRS)) rainbow trout (Oncorhynchus mykiss), Atlantic salmon (Salmo salar), sea trout (Salmo trutta) bivalve molluscs infectious diseases 11. Marteiliosis in Australian mud oyster (Ostrea angas), Chilean oyster (Ostrea chilens), the European flat or real (natural) oyster (Ostrea edulis), Argentinian oyster (Ostrea puelchan), mussels (Mytilus edulis), Mediterranean Mussels (Mytilus galloprovencial) 12. Bonamioz-Australian mud oyster (Ostrea angas), Chilean oyster (Ostrea chilens), Olympia flat oyster (Ostrea conchphil), Ostrea denselamellos, the European flat or real (natural) oyster (Ostrea edulis), Argentinian oyster (Ostrea puelchan) 13 infectious diseases of crustaceans. Baltplankum of cancer disease Decapod round Interior Minister Richard Kozlovsk by Annex 2 of the Cabinet of Ministers of 14 March 2017 regulations No 146 monitoring and control procedures and the bivalve molluscs in farms No production zones. PO box Aquaculture animal species Health Risk monitoring type inspection officers frequency the frequency of visits by the official veterinarian Specific instructions for carrying out the inspection, sampling, as well as the surveillance necessary to maintain proper health condition comments 1. Bivalve molluscs in farms or farming area is not kept in aquaculture animals susceptible to the rules referred to in annex 1 of the infectious diseases category I (communicable diseases intact bivalve shellfish farm or growing zone in accordance with this rule 90.2, 90.1, 90.4..., 93.1, 93.2.) low passive every four years every four years Extraordinary requirements to keep the infectious disease of bivalve molluscs of the farm or breeding status in accordance with the provisions of paragraph 98 of the recommended inspection frequency does not apply to the specific requirements for each medical condition. These checks and sampling combined with Service inspections and visits by the official veterinarian. Officers aim to perform inspection tests according to paragraph 5 of these rules. Veterinarian visits, aims to find out the animal health situation, to give the aquaculture industry business owners advice on aquaculture animal health issues 2. Aquaculture animals of species susceptible to the provisions listed in annex 1 of the infectious diseases category I (communicable diseases intact bivalve shellfish farm or growing zone in accordance with this rule 90.3 and 93.3) high active, targeted or passive once a year once a year on average every two years to once every two years Under every two years to once every two years (category II infectious disease affected bivalve shellfish farm or production area the surveillance programme in accordance with this provision, 75 and 76 74. high targeted) once a year once a year in accordance with the specific requirements of these rules, and 74 75 76. Point Average. every two years to once every two years Under every two years every two years the III category (it is not known whether farm or bivalve mollusc farming area is infected, and not introduced a monitoring program for infectious disease in nursery or bivalve mollusc farming area status) high active once a year on average three times a year once a year twice a year Under every two years time year 3.   Category IV (is known that bivalve shellfish farm or farming area is infected, it is subject to an eradication programme in accordance with the provisions of paragraph 77) targeted High once a year once a year-specific requirements in accordance with the provisions of paragraph 77 on average every two years to once every two years Under every two years to every two years, the category V (it is known that bivalve shellfish farm or farming area is infected It is subject to minimum control measures in accordance with the provisions of sections V, VI VII, VIII and IX) high passive every four years (specific requirements) once a year for Specific requirements in accordance with the provisions of sections V, VI VII, VIII and IX of the medium once every two years to once every two years Under every four years every four years, the Interior Minister Richard Kozlovsk the annex 3 of the Cabinet of Ministers of 14 March 2017 regulations No 146 breeding and restocking of the animal health situation for aquaculture animals and it certification zones and compartments No. PO box The health status category authorised to import animal health certification of aquaculture aquaculture animals are allowed to send to insert to export 1. (I) communicable disease free zone or compartment exclusively from category I zone or district Yes not allowed when exported to category III or V zone or compartment. If exported to category I, II or IV area or station to any category, area or station 2. (II) the implementation of surveillance and eradication program Just from class I areas or circuit Yes No To category III and V of the zone or compartment 3. (Iii) the health situation is not fixed (it is not known whether the zone or compartment is infected and is not implemented the program for infectious disease-free zone or compartment status) Of category I, II and III zones or the circuit no no To category III and V of the zone or compartment 4. (IV) the zone or compartment eradication programme is being implemented only from a category I area or station Yes Yes only to the g category zone or compartment 5. V infected zone or compartment Of any category and Precinct No Yes only to category V area or station Interior Minister Richard Kozlovsk of annex 4 of the Cabinet of Ministers of 14 March 2017 regulations no Viral haemorrhagic septicaemia 146 or infectious haematopoietic necrosis two-year surveillance programme scheme No. PO box The way health checks per year (two years), the number of sampling a year (two years), the number of Fish growing number of fish paraugā1 fish breeding skaits2 1. Farms with breeding animals (the first test) 2 2 50 75 (second test) 30 (first or second check) 0 (first or second check) 2. Nurseries that are just breeders 2 1 0 75 (first or second check) 3. Farms without breeding animals 2 2 753 (first and second check) 0 comments. 1 sampling not earlier than three weeks after the transfer of the freshwater fish brine. 2 ova of breeding animals or liquid phase of maturity is obtained with the noslaukšan method. 3 samples are taken from a number of fish, so when a disease is for 5% of the cases, viral haemorrhagic septicaemia, and infectious haematopoietic necrosis with 95% of the established reliability. 4. the maximum number of fish in aggregate – 10.
Interior Minister Rihards Kozlovsk annex 5 by the Cabinet of Ministers of 14 March 2017 rules No 146 laboratory diagnosis and sampling methods of infectious haemopoietic necrosis of salmonids or viral haemorrhagic septicaemia diagnosis 1. Organs from which samples (in aggregate allowed to combine a maximum of 10 fish organ or part): 1.1 the target tissue is the spleen, kidney and heart or head mounted on the brain. Samples taken from breeding animals may also investigate the eggs or liquid; 1.2. about 4 cm shorter fish fry, after the severed body part behind the bowel, can crush with sterile scissors or scalpel. From 4 to 6 cm long fish collected inside and kidneys. 2. In the case of viral haemorrhagic septicaemia, infectious haematopoietic necrosis or both of those infectious diseases get or keep health "infectious disease", laboratory diagnosis chooses one of the following methods: 2.1. virus isolation in cell cultures, followed by identification using imūnfermentatīv analysis (ELISA), indirect imūnfluorescenc of the antibody test (IFAT), vīrusneitralizācij test or real-time reverse transcriptase polymerase chain reaction (RT-qPCR) test; 2.2. the virus with RT-qPCR. 3. If necessary to confirm or exclude the suspicion of viral haemorrhagic septicaemia, infectious haematopoietic necrosis, or both of these infectious diseases, following inspection, sampling and laboratory examination procedures: 3.1. farm shall be at least one health check and when clinical or post mortem is observed in viral haemorrhagic septicaemia or infectious haematopoietic necrosis infectious or communicable diseases in both these features, a sample of 10 fish or When clinical or post mortem have not observed such characteristics, a sample of at least 30 fish. Samples laboratory investigates using these rules referred to in annex 13 laboratory diagnostic methods, or used: 3.1.1. conventional virus isolation in cell culture, and they take the immunochemical or molecular identification of the virus; 3.1.2. determination of the virus by RT-qPCR; 3.1.3. other diagnostic techniques with proven equivalent effectiveness, such as the indirect imūnfluorescenc antibody test (IFAT), imūnfermentatīv analysis (ELISA), RT-qPCR and immunohistochemical (IHC) analysis; 3.2. viral haemorrhagic septicaemia or infectious haematopoietic necrosis presence shall be deemed to have been approved if using one or more of these diagnostic methods, positive results have been obtained with regard to viral haemorrhagic septicaemia virus or infectious haematopoietic necrosis virus. Confirming the first viral haemorrhagic septicaemia or infectious haematopoietic necrosis in a case previously uninfected Latvian territory, zone or compartment, are based on the results obtained from conventional virus isolation in cell culture test or RT-qPCR; 3.3. If the test culture or RT-qPCR tests do not confirm the viral haemorrhagic septicaemia virus or infectious haematopoietic necrosis virus, suspicions about the presence of viral haemorrhagic septicaemia virus or infectious haematopoietic necrosis virus can be turned off. Interior Minister Richard Kozlovsk of annex 6 of the Cabinet of Ministers of 14 March 2017 regulations no Viral haemorrhagic septicaemia 146 or infectious haematopoietic necrosis four-year surveillance programme scheme No. PO box The way health checks per year sampling per year number of paraugā1 growing Fish fish fish breeding number skaits2 the first two years of the period of supervision 1. Farms with breeding animals (the first test) 2 1 0 30 (second test) 0 (first test) 0 (second test) 2. Nurseries that are just breeders 2 1 0 30 (first or second check) 3. Farms without breeding animals 2 1 303 (first or second check) 0 the last two years of the period of supervision 4. Farms with breeding animals (the first test) 2 2 30 0 (second test) 0 (first test) 30 (second test) 5. Nurseries that are just breeders 2 2 30 (first and second check) 6. Farms without breeding animals 2 2 303 (first and second check) notes. 1 sampling not earlier than three weeks after the transfer of the freshwater fish brine. 2 ova of breeding animals or liquid phase of maturity is obtained with the noslaukšan method. 3 samples are taken from a number of fish, so when a disease for 10% of cases, viral haemorrhagic septicaemia, and infectious haematopoietic necrosis with 95% of the established reliability. 4. the maximum number of fish in aggregate – 10.
Interior Minister Richard Kozlovsk the annex 7 of 2017. The Cabinet of Ministers on 14 March Regulation No. 146 surveillance scheme for health "infectious disease" in relation to the conservation of the viral haemorrhagic septicaemia or infectious haematopoietic necrosis Nos PO box Health risk number of inspections number of Fish in the sample 1. High Two times a year, 2 2 301. The average yearly 301 3. Under every two years 301 notes. 1 sampling not earlier than three weeks after the transfer of the freshwater fish brine. 2 samples from the fish, so when a disease for 10% of cases, viral haemorrhagic septicaemia, and infectious haematopoietic necrosis with 95% of the established reliability. 3 health checks Each time, take at least one sample. 4. the maximum number of fish in aggregate – 10.
Interior Minister Richard Kozlovsk of Annex 8 of the Cabinet of Ministers of 14 March 2017 regulations No 146 diagnostic and sampling methods to obtain and maintain health "infectious disease" in relation to the herpes disease koij 1. disease of herpes Koij diagnostic specimen sent tissue material that has gills and kidney. The aggregate sample is allowed to combine two parts of organs of fish. 2. In the case of herpes disease koij attain and maintain health "infectious disease", intended for monitoring diagnostic method is real-time PCR (qPCR). 3. to confirm or rule out the suspicion of being infected with the herpes koij shall respect the following sampling and laboratory examination procedures: 3.1 laboratory investigation on the sending of a herpes koij this annex referred to in paragraph 1 the requirement of appropriate samples; 3.2. if clinically or after death (post mortem) is observed in the herpes disease-specific koij signs, in the official investigation shall be at least one health check and take one sample with 10 fish or, if clinical signs or post-mortem has been observed, with 30 fish sampled; 3.3. laboratory samples investigated, subject to this provision in annex 13. diagnostic methods and procedures to exclude or confirm the herpes koij; 3.4. the herpes disease koij is considered approved, if using PCR for Herpes koij finds; 3.5. where the laboratory tests used in the presence of herpes not koij attest, suspected of the disease Herpes koij can be turned off. The herpes disease Koij two-year surveillance programme scheme table 2 A clinical inspection per year (two years), the number of years of laboratory study (two years), number of Fish farms in the sample/sampling point in the first two years of the period of supervision 2 2 751 maximum number of fish aggregate in note 2. 1 sampled from a number of fish, so when a prevalence of 5% provided for by the herpes be koij with 95% confidence in the herpes disease Koij four-year surveillance programme scheme 2. B table of Clinical Laboratory examinations per year per year, the number of Fish farms in the sample/sampling point in the first two years of the period of supervision of the farm/1 1 30 sampling points the last two years of the period of supervision note 2 2 30. The maximum number of fish in aggregate-2 surveillance scheme for health "infectious disease" in relation to the conservation of the herpes disease koij 2. Table C Health Risk number of inspections number of Fish high in the sample twice a year, the Average annual 30 30 low 30 every two years, the maximum number of fish in aggregate-2 surveillance scheme for health "infectious disease" in relation to the conservation of the herpes disease koij Latvian territory , a zone or compartment where the farms are limited and targeted monitoring does not provide enough epizootiological data 2D table of Clinical Laboratory examinations per year per year, the number of Fish in the sample the sampling points every two years to once every two years, note 30. The maximum number of fish in aggregate-2 Interior Minister Richard Kozlovsk by 9. Cabinet of Ministers of 14 March 2017 regulations No 146 of infectious salmon anemia diagnostic methods and formal studies to determine 1 infectious salmon anemia, laboratory investigation sent such samples: 1. galvasnier, liver, heart, pancreas, intestines, spleen and Gill-histological analysis; 1.2. vidusnier, heart with valves and bulb arteriosus – imūnhistoķīmisk analysis; 1.3. vidusnier and heart-RT-qPCR analyses; 1.4. vidusnier, heart, liver and spleen – viral culture. 2. in the aggregate authorized to combine up to five fish organ parts. 3. in order to obtain or maintain health "infectious disease", the laboratory uses RT-qPCR diagnostic method. Positive samples are then sekven, making use of this provision in annex 13 laboratory diagnostic methods and respect. 4. If the RT-qPCR is positive before this provision provided for in paragraph 48 of the initial implementation of control measures in addition to laboratory investigates further specimens. 5. when using the rules referred to in annex 13 of laboratory diagnostic methods and subject to the procedures of screening carried out on samples with RT-qPCR, also the gene to sekven HE verify the presence or absence of the virus, which is not expressed in the genome of the polimorfisk region, and uses one of the following techniques: 5.1 the tissue preparations investigated with specific infectious salmon anemia virus antibody (fixed cuts with the IHC, imprint, with IFAT); 5.2. at least one sample from any fish on the farm to check out samples of isolates and identifies the infectious salmon anemia virus in cell culture. 6. In accordance with paragraph 48 of these rules confirm or rule out the suspicion of infectious salmon anemia, following a formal investigation procedure and diagnostic procedures: 6.1. If the formal investigation during the clinical or post mortem for infectious salmon anemia is observed in infection-specific features, at least one health check and take one sample with 10 dying fish. When clinical or post mortem for infectious salmon anemia-specific features have been observed, and health checks in accordance with this provision and paragraph 216.217 selective samples from at least 30 fish dying or recently dead fish (with normal body composition). Samples laboratory investigates using paragraph 6.2. of this annex in specific diagnostic techniques; 6.2. If the RT-qPCR method in respect of infectious salmon anaemia virus with genotype IL (without IPRS) a positive result is obtained before this provision, paragraph 48 initial control measures laboratory investigates further specimens. Using these rules laid down in annex 11. laboratory diagnostic methods, a suspected contamination with infectious salmon anemia is approved if one of the following: 6.2.1 of infectious salmon anemia is found in a virus with RT-qPCR, also sekvenēj a gene to make sure HE'S on the virus genome, which is not expressed in the polimorfisk region, and with specific infectious salmon anemia virus antibody (fixed cuts with the IHC but the imprint, with IFAT) infectious salmon anemia virus detected in tissue preparations; infectious salmon anemia 6.2.2 virus by RT-qPCD method, the sekvenēj HE also gene in order to verify the presence of the virus genome is not expressed in the polimorfisk region, as well as with at least one sample from any fish on the farm, infectious salmon anemia virus isolates and identifies the cell culture; 6.3. Wells, which clinically observable pathological changes of heavy or histopathological evidence of infectious salmon anemia virus studies carried out with the approval of two diagnostic methods that are based on independent detection principles (such as the RT-qPCR and IHC). 7. Suspected infectious salmon anemia may be excluded if it is established that in the 12 months since suspected in laboratory studies and tests no evidence for the presence of infectious salmon anaemia. The two-year control period surveillance scheme, implemented before the health status of the "infectious disease" acquisition in relation to infectious salmon anemia 3. Table A year of Monitoring health checks per year (two years), the number of years of laboratory study (two years) on the significant number of samples 1 6 21 2 x year year 6 21 2 x 752 752 2 notes. 1 year of samples taken must be stored and to investigate the two month long testing periods (spring and fall) or when it is appropriate for practical reasons. 2 the maximum number of fish-5 aggregate.
Health surveillance scheme "infectious disease" saglabāšanai2 in relation to infectious salmon anemia 3. B table. PO box Risk health checks per year, the number of years of laboratory study year sample of fish to be number 1. High x 30 2 2 21 2. Medium 1 11 30 3. Under every two years every two years 30 times within two years of notes. 1 samples must be taken during the year and to investigate the two month long testing periods (spring and fall) or when it is appropriate for practical reasons. 2 do not apply to farms that grow only in rainbow trout (Onchorhynch mykiss), Brook trout (Salmo trutta), or both, and where the water is only freshwater supply from sources that do not live in the Atlantic salmon (Salmo salar).
Interior Minister Rihards Kozlovsk annex 10. Cabinet of Ministers of 14 March 2017 regulations No 146 marteiliosis diagnostic methods and formal studies 1. Sample laboratory examinations is the whole body of bivalve molluscs. 2. In relation to infection with Marteilia refringens get or maintain health "infectious disease", used this provision in annex 13 laboratory diagnostic methods, histopathology, tissue prints or PCR. 3. to officially confirm infection with Marteilia refringens or off the suspected contamination with it, subject to the following tests, sampling and laboratory examination procedures: 3.1 after Marteilia refringens prevalence period started in the organized health check and get one with 30 of official samples of bivalve molluscs susceptible species, if the suspicion is based on the news of the deaths, or with 150 animals of susceptible species in bivalve molluscs, where news of the deaths was not. If Marteilia refringens prevalence period is not known, start to take samples of the season, when the water temperature has exceeded 17 ° C; 3.2. laboratory investigation: 3.2.1. Marteilia refringens presence shall be considered approved if a positive result is obtained not only with histopathology, tissue prints or in situ hybridization, but also with the PCR, after which the sequencing; 3.2.2. suspicion of infection with Marteilia refringens may be excluded if the tests referred to in point 3.2.1 of Marteilia refringens presence shows no sign. Supervisory control scheme in the period before the health infectious disease "," acquisition for table 4A marteiliosis health checks per year number of laboratory study year sample of bivalve shellfish growing area surveillance scheme 1 1 150 health infectious disease "" save on table 4B marteiliosis No. PO box Health risk number of inspections number of laboratory examinations of molluscs in sample 1. High once a year once every two years, 150 2. On average every two years to once every two years, 150 3. Under every two years every four years 150 Interior Minister Richard Kozlovsk a annex 11 cabinet 2017 14 March regulations No 146 bonamiosis diagnostic methods and criteria 1. Sample laboratory examinations is the whole body of bivalve molluscs. 2. In relation to infection with Bonamia Ostrea get or maintain health "infectious disease" (category I), is used in this provision in annex 13. diagnostic methods, histopathology, imprint, or PCR. 3. to officially confirm infection with Bonamia Ostrea, or turn off the suspected contamination with it, subject to the following tests, sampling and laboratory examination procedures: 3.1. organized health check and get one with 30 of official samples of bivalve molluscs susceptible species by distribution of Bonamia Ostrea period started, if the suspicion is based on the news of the deaths, or with 150 animals of susceptible species in bivalve molluscs, where news of the deaths was not. If the transmission period is not known, start to take samples in the winter or in early spring; 3.2. the laboratory investigation: 3.1.1 Bonamia ostreae presence be deemed to be approved if additional positive result obtained with tissue histopathology, prints or in situ hybridization, such a result is obtained, after which the PCR sequencing; 3.1.2. suspicion of Bonamia ostreae infection can be turned off, if the tests referred to in paragraph 3.1.1 of the Bonamia ostreae presence is not evidence. Supervisory control scheme in the period before the health infectious disease "," acquisition with regard to Bonamia ostreae table 5A health checks per year number of laboratory study year sample of bivalve shellfish growing areas supervisory scheme 1 1 150 health "infectious disease" preservation with regard to Bonamia ostreae (B) table no. 5. PO box Health risk number of inspections number of laboratory examinations of molluscs in sample 1. High once a year once every two years, 150 2. On average every two years to once every two years, 150 3. Under every two years every four years 150 Interior Minister Rihards Kozlovsk. Annex 12 Cabinet 2017 14 March regulations No 146 of baltplankum disease in Cancer diagnostic methods and sampling procedures samples of 1 cancer diagnosis of the disease is baltplankum: 95% ethyl alcohol 1.1 fixed the epidermis (foot, vēderkāj, part of the mouth or Gill); 1.2. other samples with a fixation for histological examination prepared and mikroskopēšan with a transmission electron microscope to perform PCR. 2. In the case of baltplankum disease cancer get or keep health "infectious disease", used this provision in annex 13. diagnostic method-divsoļ-PCR. 3. If the PCR test divsoļ a positive result is obtained before this rule 48, paragraph control and eradication measures, confirmed by Amplicon, sekvenēj-if possible, sample taken in susceptible saimniekorganismo with histological examination and transmission electron microscope demonstrating in practice through the patognomisk cancer baltplankum symptoms of the disease. 4. where, in accordance with the rules in paragraph 48 above requirements necessary to approve the baltplankum cancer disease infection suspected or off, following a formal investigation, sampling and laboratory investigations: 4.1 if the clinical or post mortem observed cancer baltplankum of the characteristics of the disease, the official investigation shall be at least one health check and take one sample with 10 crustaceans or, if clinical signs or post-mortem does not observe , a sample with 150 crustaceans. Samples laboratory investigates using 2 and 3 of this annex as described in paragraph divsoļ of the PCR; 4.2. the cancer baltplankum the presence of the disease shall be deemed to have been approved if the PCR divsoļ, after which the sequencing for baltplankum syndrome virus type 1 is positive and if the sample taken is observed in the saimniekorganismo patognomisk cancer baltplankum symptoms of the disease. 5. If the laboratory referred to in paragraph 4, the study of cancer baltplankum during the presence of the disease is not evidence, suspicion of cancer diseases of baltplankum excluded. Surveillance scheme two-year control period before health infectious disease "," acquisition for baltplankum disease of cancer 6. Table A of Clinical Laboratory examinations per year per year number of crustaceans in the sample farms/sampling point 1 1 150 surveillance scheme health infectious disease "" saving for baltplankum disease of cancer 6. B table. PO box The health risk of the laboratory study of the number of inspections number of crustaceans in the sample 1. High once a year once every two years, 150 2. On average every two years to once every two years, 150 3. Under every two years every four years 150 Interior Minister Richard Kozlovsk by the Ministry of Agriculture presented the annex 13. Cabinet of Ministers of 14 March 2017 regulations No 146 laboratory diagnostic methods i. in laboratory diagnosis methods and the viral haemorrhagic septicaemia infectious haematopoietic necrosis in this chapter have been monitoring laboratory diagnostic methods used to obtain or maintain health "infectious disease" of viral haemorrhagic septicaemia and infectious haematopoietic necrosis. 1. Fish sample preparation and shipping arrangements. 1.1. Samples of cell culture for virological examination shall prepare in the following order: before shipping or transportation to the laboratory in the target organ of the fish body removed with sterile dissection tools and inserts a sterile plastic tubes to transport feed. Cell culture virological investigation and RT-qPCR fish material required quantity depends on size of fish. For example, fish larvae, the length of which is less than 4 cm, all fish larvae sampled body, 4 to 6 cm long fish-guts along with the kidney, about 6 cm bigger fish – having kidney, spleen, heart and/or brains, but breeding fish spawning time-take ova liquid. Sterile tube that is not less than 4 ml transport medium, place the eggs or sperm, fish larvae, or a fish organ parts, for a maximum of ten fish, forming one of the sample letters. Each individual sample tissue weight, not less than 0.5 grams. Cell culture virological investigation started as soon as possible after the arrival of the sample in the laboratory, but not later than 48 hours after sampling. In exceptional cases, if the material is protected by transport medium and if during transport comply with the requirements for the transport of the sample temperature, as defined in paragraph 2 of this section, start of virological investigation may not later than 72 hours after the collection of the sample material. 1.2. Samples for reverse transcriptase polymerase chain reaction analysis (RT-PCR or RT-qPCR) prepared in the following order: samples from the fish using a sterile instrument shall be taken in accordance with this chapter 1.1. the procedure described in point and placed in a sterile plastic tubes to transport feed. One tube can be inserted into samples of 10 fish, and they form one of the sample letters. If the inoculum is not large, the tissues may be used no more than five fish. Samples by following the manufacturer's recommendations, set the ribonukleīnskāb are allowed (RNA) of stabilizējošo reagents (for example: to use 0.2 ml of reagent 1 g of tissue). If the material used for extraction is small, each fish handled separately and does not require the kopoto samples. To the lab allowed to send whole fish. 2. Fish samples sent to the laboratory in the following order: during transport of samples to the laboratory provides sample cooling. Test tubes with the culture or RT-PCR/RT-qPCR analysis for fish tissue transport medium, transmitted together with sufficient ice or alternate cooling environment and placed in insulated containers (for example, polystyrene boxes with thick walls). During transport is not acceptable sample freezing. Sample temperature during transport must not exceed 10 ° C, and transport box, receive a laboratory, it must be ice or one or more partially or completely frozen in the cold element containing blocks. If during transport may provide the environment to meet the preceding paragraph above requirements for temperature, can be sent to the laboratory of whole fish. Whole fish wrapped in absorbent paper, which places a plastic bag. You can also send live fish. 3. additional diagnostic material collects in the following order: If the diagnostic the laboratory's permission, collect and prepare additional studies may also other fish tissues. 4. preparation of the sample cell culture and RT-qPCR investigation. 4.1. Permitted to perform sample freezing in exceptional cases. If the sample processing 48 hours after the collection of fish tissue is not possible, it is acceptable to freeze the tissue sample transport medium at-20 ° C or lower temperature and virological investigations to take 14 days. Before the investigation of samples of fish tissue allowed to freeze and thaw only once. Freezing samples indicates detailed information about each fish freezing tissue samples. 4.2. consideration of organs in a laboratory tissue serving tubes completely homogenised (either by Stomacher, blender, blender or mortar and pestle with sterile sand) and then suspended in the original transport medium. If a sample consisted of whole fish smaller than 4 cm, it differentiates the body part behind the intestinal opening and then part of such fish minced with sterile scissors or scalpel. If a sample consisted of whole fish, which has a length of 4 to 6 cm, collect the fish innards, including the kidneys. If a sample consisted of whole fish longer than 6 cm, tissue samples as described in point 1 of this chapter. Tissue samples are minced with sterile scissors or scalpel, homogenised (either by Stomacher, blender, blender or mortar and pestle with sterile sand) and then suspended in the original transport medium. The final ratio between tissue material and transport medium in the laboratory shall be adjusted to achieve 1:10.4.3. centrifugation of Homogenized the homogenised material material for 15 minutes in a centrifuge refrigerated centrifuge at 2 ° C to 5 ° C at 2000 to 4000 revs/minute, and collect the supernatant. After the acquisition, the supernatant for four hours at 15 ° C, or all night 4 to 8 ° C is treated with antibiotics. Transport medium sent samples of the supernatant with antibiotics may not be processed. If inoculate the cell can not 48 hours after the fish tissue samples, the supernatant is allowed to freeze-80 ° C and virological investigations to take 14 days. If the collected supernatant after 48 hours of the sampling stored in-80 ° C, it can only be used once for virological examination. Before inoculation of cell supernatant is mixed with equal parts according to the letters of the diluted antiserum of infectious pankreātisk necrosis virus serotypes and the local with this mixture of not less than one hour are incubated at 15 ° C, or up to 18 hours at 4 ° c. The titre of the antiserum is 50% of the test is in Plaka at least 1:2000. All inocula with infectious pankreātisk necrosis virus Antisera. The procedure is therefore needed in order to prevent the effect of a cytopathic (CPE) by the inoculated cell cultures causing infectious pankreātisk necrosis virus development. Consequently, this reduces the duration of the virological examinations as well as the number of cases that should be considered as the result of a CPE suggest viral haemorrhagic septicaemia or infectious haematopoietic necrosis virus. If the sample is from the production units, which are free of infectious pankreātisk necrosis, inoculum with infectious pankreātisk necrosis virus Antisera can not be processed. 4.4 sample preparation monitoring programs based on RT-PCR and RT-pPCR samples placed in transport medium, this chapter 4.2 and 4.3 of the procedures described in the subparagraph. After centrifugation the supernatant collected and extracted RNA. If directly after centrifugation does not need to do further investigation, the samples are immediately frozen − 20 ° C or lower temperature. Ribonukleīnskāb's reagent in the manufacture of preserved fish stabilising tissue analysis needs further work with different temperature stored samples carried out in accordance with the following timetable: 37 ° C stored samples: one day, 25 ° C stored samples: one week, 4 ° C stored samples: one month,-20 ° C store: open-end. With a couple samples RNA stabilising agent acting in the same way as the individual samples in the RNA stabilising agent. RNA stabilising agent works in the sample amount shall not exceed the amount applicable to the RNA extraction Kit (such as the RNeasy mini kit (Qiagen) or similar) recommended by the manufacturer. If the samples are larger works, extraction kits or methods must be such as to meet the following shaped letters samples. RNA stabilizējošo cannot be collected samples not used for cultivation of cells. 4.5. Action with a couple samples for investigation with the RT-qPCR method provided in this chapter, RT-qPCR Protocol sensitivity is equivalent to cell culture methods or sensitivity is on the top. PCR needs can use the supernatant from the cell culture medium, homogenized fish tissue material taken not more than 10 letters from the organs of fish. Compared to the cultivation of cells used in the PCR test much smaller inoculum, so before to put together material extraction, all fish should be carefully homogenize the tissue. The same principle must be observed even when the samples are collected in the RNA stabilizējošo reagents. If a representative from 10 fish in one test tube to collect is difficult, the number of fish in the sample letters reduced to 2-5 fish. 5. cell culture virological investigation 5.1. Cell Culture and medium temperature 20 to 30 ° C in a suitable medium, namely the Īgl medium MEM or its modified version by adding 10% fetal bovine serum and antibiotics, oxygen, zilžaun of saulesziv for grown cell lines-2 (BF-2), rainbow trout gonadal cell lines-2 (RTG-2) and the papulos of either Epitheliom (EPC) or cyprin masked mailīt (FHM) cells. If the cells are incubated in closed vials, medium with bicarbonate buffer. The medium used for cultivation of cells in open containers, can be buffered with TRIS-(hydroxymethyl) aminomethane-HCl (TRIS-HCl) (23 mM) and sodium bicarbonate (6 mM). the pH must be 7.6 +-0.2. Cell cultures intended to inoculate with fish tissue material will be new (usually, if possible, they are one day old cell culture Monolayers). In the event of exceptions is an acceptable age range 4 to 48 hours. Cells in the inoculum should be actively growing. 5.2. inoculation of cell cultures to prevent homologous interference, with antibiotics treated organ suspension is inoculated cell cultures in two dilutions: the primary dilution and, in addition, the dilution 1:10. final dilution of tissue material to medium with cell culture will be 1:100 and 1:1000, respectively. According to section 5.1 of this chapter describes the procedure for at least two of the inoculated in these cell lines. The ratio between inoculum size and cell culture medium containing volume should be about 1:10. Each dilution and each cell line used at least 2 cm2 cell area, which corresponds to one of the 24-well culture plate well. If possible, use a cell culture plate. 5.3. cell culture incubation of inoculated cell cultures incubated for 7 to 10 days 15 ° C. If the observed medium acidification (with cell culture medium changes color from red to yellow), with sterile bicarbonate solution or equivalent substances adjusts the pH of the medium, to ensure that the cells are still susceptible to virus infection. At least once every six months or when the suspected cell, entrepreneurship would frozen viral haemorrhagic septicaemia virus or infectious haematopoietic necrosis virus is titrated to verify the susceptibility of the cell cultures to infection. If possible, use this in chapter III of the annex to the described procedure. 5.4. Microscopy Inokulētaj cell cultures no less than three times a week for 40 to 150 times magnification view CPE occurred or not. If explicit CPE is observed immediately in accordance with paragraph 6 of this chapter the procedures of starting virus identification procedures. 5.5. cell overseeding If after 7 to 10 days of incubation of the primary CPU is not occurred, dressing to new culture cell cultures using the same cell as the primary crop of the area. After 7 to 10 days after inoculation, along the lines of cells together all primary culture or cultures that make up wells of the medium (supernatant) aliquot. The kopoto samples as described in point 5.2 of this chapter, undiluted and diluted 1:10 (winning the final supernatant dilutions, 1:10 and 1:100 respectively) inoculated into homologous cell cultures. Allowed primary culture medium inoculate the aliquot desmitprocentīg directly trough the new cell culture (transfer from wells the recess). Before you inoculate dilutions, as described in section 4.3 of this chapter, you can advance at the infectious pankreātisk necrosis virus of the dilution of antiserum. The inoculated cultures incubated for 7 to 10 days 15 ° C and examined in accordance with this chapter 5.4. If toxic CPE occurs in the first three days of incubation, cells, casts, at this stage, then incubated for 7 days, dressing and again further incubated for seven days. If toxic CPE occurs later than in three days, the cells can take one passage and incubate them so that from the first inoculation total would be 14 days. Last seven days of incubation, no signs of toxicity may not be. If, despite the fact that the processing is carried out with antibiotics, bacterial contamination occurs, before the transfer of 15 to 30 minutes 2 to 5 ° C up to 4000 x 2000 make centrifugation speed/minute or 0.45 μm filtering of the supernatant with a filter or both of the following (the membrane with low protein binding capacity). Moreover, the services in respect of the same procedures for toxic CPE described in the fourth paragraph of this point. If the CPE does not occur, the test result may be declared negative. 6. Virus identification If observations indicate that in cell culture is the CPU, the medium (supernatant) is collected and checked by one or more of the following techniques: imūnfermentatīv analysis (ELISA), imūnfluorescenc (IF), neutralisation, RT-PCR or RT-qPCR. If these tests within one week of the virus has not been possible to definitively identify for immediate identification sent to another European Union reference laboratory. 6.1. The Elisa virus isolates shall be identification of the Elisa immunoassay with two antibodies. Microtitre plates spread coverage, quantity 50 ml per hole (0.9 pg) pipette from the rabbit Antisera against viral haemorrhagic septicaemia virus or infectious haematopoietic necrosis virus for proven quality purified A protein immunoglobulins (Ig) carbonate buffer (pH 9.6) with sodium azide contains 15 mM, and from 18 hours to 2 weeks are incubated at 4 ° C. Plate each sample solution containing 1% Triton X-100, and the positive control samples are diluted with buffer (bovine serum albumin in buffer phosphate physiological PBS-T, BSA 1%): four dilutions undiluted, 1:4, 1:16, 1:64. Elisa plates are washed in phosphate physiological in PBS containing 0.05% Tween-20 (PBS-T), and wash and needled the coated Elisa plate enter 50 µ l of each solution the solution concentration of the plate. Then Elisa plate incubate 30 minutes at 37 ° c. Then the plates are washed and 30 minutes at 37 ° C incubate with specific monoclonal antibodies (specifically, the viral haemorrhagic septicaemia virus identification with MAb and IP5B11 infectious haematopoietic necrosis virus identification respectively with Hyb 136-3). Elisa plate add 50 µ l of rabbit pretpel of the horseradish peroxidase conjugate antibody dilutions with PBS-T-BSA 1:1000. After rinsing, propose response, add to each well 50 µl of orthophenylene diamine (OPD). Elisa plates in the dark at room temperature for 20 minutes and incubate the reaction stops, each well 100 ml 0.5 M H2SO4 by adding. Elisa lasāmierīc absorbenc of the monitor in a wavelength of 620 nm. 492 and By comparing test results with positive and negative controls samples absorbenc values referred to as positive or negative. In General, samples which are not diluted material in absorbenc (A) common < 0.5, considered negative samples with A value of 0.5 to 1.0 deemed suspicious and samples having A > 1.0, considered positive. Elisa referred to in this paragraph, you can use a variation of the other recount equivalent effectiveness. 6.2. IF the Imūnfluorescenc-Viral haemorrhagic septicaemia and infectious haematopoietic necrosis virus are identified:-infecting cells in 96-well plates of "Black"; -infecting cells in 24-well plates normal or 24-well plate stage. If the viral haemorrhagic septicaemia or infectious haematopoietic necrosis virus or both identifies the infecting the cells to the stage, acting according to the following protocol: (a) to prepare a stage cell densities to after 24 hours of culture should 60% to 90% konfluenc. If possible, for this purpose, it is recommended that ECC cells because they firmly stick to glass surfaces but can just as well use other cell lines-such as BF-2, RTG-2 or FHM. 150 µl cell culture supernatant in two different dilutions (1:10 and 1:1000) must be inoculated in duplicate one day old monoslāņo and incubated for 24 hours at 15 ° C; (b) then to the cell culture medium shall be removed and the infected cell Monolayers in 0.5 ml of ice cold recorded with acetone in aqueous solution (80% by volume). Fixation at room temperature for 15 minutes, take the fume cupboard, then from the acetone solution is free and for coating dry for at least 30 minutes in the air. At this stage the boards either treated immediately or-20 ° C store for further use; (c) specific monoclonal antibodies (specifically, the viral haemorrhagic septicaemia virus identification, while the MAb IP5B11 infectious haematopoietic necrosis virus identification of 136-3 Hyb) 0.01 M PBS to dilute, pH 7.2 a dilution as recommended MAb supplier; fixed to add 50 to 100 monolayer μl per hole, and wet plate camera in one hour are incubated at 37 ° C; (d) the coverslip three times with 0.05% gently Tween-20-containing phosphate buffer (PBS-T) and after the last rinse of the whole buffer is freed. Then the cells incubated for one hour at 37 ° C for primary antibodies using mouse immunoglobulin antibody fluorescīn isothiocyanate (FITC) or a filter for tetramethylrhodamine-5-(and-6-) using (TRITC are RECOMMENDED), in accordance with the supplier's instructions, rinse again diluted in PBS-T and dry. Colored crops placed on slides, using glycerol saline solution and verify the incident ultraviolet (UV) light. Use the 10 x and 12 x eyepieces and x 25x or lens Magnifier with a numeric aperture 0.7 and 1.3, respectively. Alternatively < < for cell cultures, fixation and antibodies can be used in cases of other IF techniques with proven equivalent effectiveness. 6.3. the neutralization of the supernatant were harvested, by centrifugation (2000 to 4000 x revs/minute) or by filtration through a membrane filter (0.45 µm) with a low protein binding membrane separates the cells and supernatant with cell culture medium, dilute and 1:10000.1:100 at least two aliquots of the dilution of the supernatant separately mixed with equal parts of the following reagent and then incubate for 60 minutes at 15 ° C: a) serum containing group specific antibodies to the viral haemorrhagic septicaemia virus dilution of 1:50 (strength); b) serum containing group specific antibody against infectious haematopoietic necrosis virus dilution of 1:50 (strength); (c) works of Antisera against) local infectious pankreātisk necrosis virus serotypes dilution of 1:50 (strength); d) only feeds (positive control). Each virus supernatant-serum mixture and at least two of the inoculated cell cultures, with 50 μl each and then incubated at 15 ° c. Taking into account this chapter 5.4 in certain characteristics, make sure that the CPE does not arise. Viral haemorrhagic septicaemia virus strains and isolates that react in the neutralisation tests, identified by IFA or ELISA. Alternatively, you can use other neutralisation tests with proven effectiveness equivalent. 6.4. RT-PCR/RT-qPCR 6.4.1. Viral RNA preparation for all transactions with the RNA take the gloves on the ice. Ribonukleīnskāb-extracted with phenol-chloroform method or the affinity of ribonukleīnskāb Rotary tube, in accordance with the manufacturer's instructions. May be used for the marketing of available RNA extraction kits with which you want the high-quality RNA, suitable for use in RT-PCR Protocols described below. Ribonukleīnskab repeatedly suspended in distilled water free from from (i.e. 0.1% dietilpirokarbonāt treated with water) or the appropriate Elution buffer. 6.4.2. RT-PCR infectious haematopoietic necrosis virus detection uses the following primers: primers: 5 ' direct-AG-GAT-CCC-TAC-ACC-AG-GAC-3 '; reverse Primer: 5 '-GG-GG-GT-GT-TCC-GTG-CA-3 '. Using such cycles (viensoļ RT-PCR): 1 cycle: 50 ° C for 30 min; 1 cycle of: 95 ° C 2 min; 30 cycles: 95 ° C, 50 ° C for 30 seconds 30 seconds 60 seconds 72 ° C; 1 cycle of 72 ° C for 7 min and: soak 4 ° C. Viral haemorrhagic septicaemia virus detection uses the following primers: VN direct: 5 '-ATG-GA-GG-GG-att-CGT-GA-GCG-3 '; VN reversible: 5 '-GCG-GTG-AAG-TGC-TGC-AG-TCC-C-3 '. Using such cycles (viensoļ RT-PCR): 50 ° C for 30 min, 95 ° C for 15 min 35 cycles of 94 ° C with 30 seconds, 55 ° C for 30 seconds 68 ° C for 60 seconds. Then 68 ° C for 7 minutes allows the reaction to take place. RT-PCR reaction and specificity evaluates gel electrophoresis in 1.5% agarose gel with ethidium bromide and observed under ultraviolet caurgaismošan. With regard to infectious haematopoietic necrosis virus of 693 PCR Amplicon can be observed in the bp. With regard to viral haemorrhagic septicaemia virus of this size is 505 bp. PCR results can vary depending on its execution, i.e. depending on the DNA (DNA) of the amplifikator may be necessary to optimize the amplificēšan protocols. Wrong primer hybridization or laboratory contamination can be obtained due to false positive results. Therefore, in order to avoid any doubt, should include sufficient positive and negative controls and the Amplicon sequencing. With regard to viral haemorrhagic septicaemia virus primers specific to act carefully with the BF-2 cells because the primers can react with cell lines, DNA/RNA giving similar size viltuspozitīv results. Testing of the BF-2 cells for the supernatant, PCR fragments to amplificēt all sekven. RT-qPCR 6.4.3. viral haemorrhagic septicaemia virus detection of Viral haemorrhagic septicaemia virus detection amplificēšan is carried out with the following primers and prov: direct Primer: 5 '-AAA-CTC-GC-GG-TG-GTG-CGT-CC-3 ', reversible Primer: 5 '-GCG-ATC-TC-TC-GTC-AGG-ATG-AA-3 ' and 5 '-prov: FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1. Viensoļ-RT-PCR shall include in each iteration of the extensive negative control samples and templates for positive control samples. Ciklēšan conditions: 50 ° C for 30 min, 95 ° C for 15 min, 40 cycles with 94 ° C for 15 s, 60 ° C, 72 ° C 40 s 20 s; If necessary, adjusted. The variant described in the site may the use of other RT-PCR or RT-qPCR variants with proven equivalent effectiveness. 6.4.4. RT-qPCR IHNV detection infectious haematopoietic necrosis virus of amplificēšan is carried out with the following primers and prov: direct Primer: 5 '-AGA-GCC-AAG-GC-CTG-TGC-G-3 ', reversible Primer: 5 '-TTCTTTGCGGCTTGGTTG-3 ' and 5 ' prov: 6F-TGAGACTGAGCGGGAC-NFQ/MGB. Divsoļ RT-qPCR test below is based upon the divsoļ amplification. To avoid kontaminēšan, with both reaction tubes act very cautiously. Conditions of Ciklēšan (after the RT step): 50 ° C for 2 min, 95 ° C for 10 min, 95 ° C 40 cycles with 15 seconds and 60 ° C for 1 min (adjust if necessary). The variant described in the site may also use other RT-PCR or RT-qPCR variants with proven equivalent effectiveness. II. Laboratory diagnostic methods for the diagnosis of disease or suspected of being infected with the exclusion of viral haemorrhagic septicaemia or the infectious haematopoietic necrosis virus 1. Conventional virus isolation with subsequent identification of the virus for Investigation at least 1.1 10 fish that show typical viral haemorrhagic septicaemia or infectious haematopoietic necrosis. 1.2. preparation of samples of Fish and send it by ordinary virus isolation needs, follow this chapter I of the annex set out in paragraph 2 of the methods and procedures. 1.3. Additional diagnostic material collection by ordinary virus isolation needs, follow this chapter I of the annex set out in paragraph 3 of the techniques and procedures. 1.4. Sample preparation cell cultures in investigation, carried out by the conventional virus isolation needs, follow this chapter I of annex 4 of the above methods and procedures. 1.5. Cell Culture virological investigation carried out by the conventional virus isolation needs, follow this chapter I of the annex referred to in point 5, methods and procedures. 1.6. Virus identification by conventional virus isolation needs, follow this chapter I of annex 6 of the established methods and procedures. 2. detection of virus by RT-qPCR 2.1. Sampling to detect viruses by RT-qPCR, follow this chapter I of the annex referred to in point 1.2 of the methods and procedures. 2.2. Fish samples for the detection of the virus by RT-qPCR is prepared and transmitted pursuant to this chapter I of the annex set out in paragraph 2 of the methods and procedures. 2.3. additional diagnostic material in the collection that is used to detect viruses by RT-qPCR, follow this chapter I of the annex set out in paragraph 3 of the techniques and procedures. 2.4. preparation of the Sample to detect viruses by RT-qPCR, comply with this Annex i., Chapter 6.4.1. in point methods and procedures. 2.5. the detection of virus by RT-qPCR followed chapter I to this annex, 6.4.1 and 6.4.3.6.4.4. in point methods and procedures. 3. other diagnostic techniques in accordance with chapter I to this annex 4.3. Description of the prepared supernatant point may be submitted to the ELISA, indirect imūnfluorescenc of the antibody test (IFAT) or RT-PCR, respectively, in accordance with Annex I of this chapter 6.1, 6.2 or 6.4. Tissue material can use other diagnostic techniques, such as frozen cuts – indirect fluorescent antibody test (IFAT) or formalin fixed tissue material in-immunohistochemical analysis. These speed techniques 48 hours from the time of sampling, supplemented with 1 or 2 of this section to the appropriate paragraph of virological investigation if: (a) a negative result) or (b)) with material taken from the first infectious hametopoētisk necrosis of viral haemorrhagic septicaemia or, in the case of tissues, of a positive result. III. procedures for Titration procedure susceptible cell culture contamination detection against making this chapter I of the annex of the titration referred to in 5.3 that ensure cell susceptibility to contamination of crops, follow the procedures described below. Use at least two viral haemorrhagic septicaemia virus isolates and at least one infectious haematopoietic necrosis virus isolates. Isolates representing major groups of the virus in the European Union, namely, with regard to viral haemorrhagic septicaemia virus one pathology that isolates obtained from freshwater rainbow trout, and one isolate that pathology in sea water is obtained from the turbot, but with regard to infectious haematopoietic necrosis virus-one pathology strain, which the Union obtained from rainbow trout. Used for Member States of the European Union express isolates. Viral haemorrhagic septicaemia virus cell kultūrkolb with small cell culture Passage numbers multiply the BF-2 or RTG-2 line of the party, while the infectious haematopoietic necrosis virus-EPC or FHM party line. Use the medium with cell culture containing at least 10% serum. Inoculation use low infectivity of multiplicitāt (MO) (< 1). When the full CPE in cell culture supernatant by centrifugation for 15 minutes at 2000 x revs/minute, collect, sterilize the virus through 0.45 μm membrane filter and distributed by the kriomēģen labelled. The virus is kept at-80 ° c. A week after freezing three tubes with each replicated virus melt under cold water and titrated on their respective cell lines. Each virus isolate thaws and titrated at least every six months or if there is a suspicion that has fallen cell lines entrepreneurship would. Titration procedures must be described in detail, and each must follow the same procedure. Titration by end-point dilution dilution step each used at least six replicated samples. Compared with the above title obtained in the subtitles. If any of the three virus isolates compared with the original title and reduced by a factor of 2 or more window, under the supervision of the cell line is no longer used. If the laboratory there different cell lines, individual inspection of each line. The laboratory records of diagnostic examinations, keep not less than 10 years. IV. Laboratory diagnostic methods for the diagnosis of disease or suspicion off of being infected with the herpes virus disease Koij 1. sample preparation fish Diagnostic purposes and send for testing by PCR or qPCR based on conventional methods can be used live or killed and separately sealed in aseptic containers packaged fish or, Alternatively, frozen organs or organ pieces 80 to 100% canned alcoholic or viral transport medium (48 hours for processing from the time of collection). The herpes virus Koij detection sought gills and kidneys. Separate additional sample may include the spleen, brains and intestines. Acute cases can set the material tissue from up to five fish. In certain cases (for example, if there is suspicion of KHV) can not use lethal samples, such as blood smears from the gills, Gill biopsy, mucous scrapes. It can handle very valuable fish. 1.1. extraction of Dna DNA extracted according to standard operating procedures. May use the available DNA extraction kits with which you want the high-quality DNA suitable for use in this chapter referred to in paragraph 2, the PCR Protocols. 2. the agent detection and identification methods based on polymerase chain reaction (PCR) detection of KHV Koij qPCR 2.1 the herpes virus detection of the qPCR uses the following test: direct qPCR Primer (KHV-86f): 5 '-GACGCCGGAGACCTTGTG-3 ', reverse Primer (KHV-163r): 5 '-CGGGTTCTTATTTTTGTCCTTGT-3 ' and prov (KHV-109p): 5 '-CTTCCTCTGCTCGGCGAGCACG-3-FAM '. Ciklēšan conditions: one cycle with 95 ° C for 15 min, followed by 40 cycles of 94 ° C with 15 seconds and 60 ° C for 60 seconds. In each iteration, the widespread negative template inserted control samples and positive control samples. However, the described option can be used instead of other variants of proven qPCR equivalent effectiveness. 2.2. PCR for the detection of KHV uses the test described in this paragraph in which the mērķgēn is the timīn of the herpes virus koij is kināz (TK) gene. However, the described option you can use other PCR tests, which is a proven test described equivalent sensitivity and specificity. Direct Primer (KHV-Selling): 5-GGGTTACCTGTAC ' GAGA-3 '; reverse Primer (KHV-TKr): 5 '-CACCCAGTAGATT-TGC-3 '. Ciklēšan conditions: one cycle with 95 ° C for 5 min, then 35 cycles with 95 ° C 52 ° C in 30 seconds, 30 seconds, and 72 ° C for 1 min cycle with 72 ° C For 10 min. size of the product should be bp 409. PCR results can vary depending on its execution, i.e. depending on the DNS amplifikator may be necessary to optimize the amplificēšan protocols. Wrong primer hybridization or laboratory contamination can be obtained due to false positive results. In each iteration, the widespread negative template inserted control samples and positive control samples. However, the described option you can use other PCR variants with proven effectiveness equivalent. The first findings of a territory either by the method of sequencing, or for immediate identification of the virus sent to Latvia's national reference laboratory and other Member States of the European Union reference laboratory. V. laboratory methods of diagnosis of herpes virus Koij disease monitoring in this chapter have been sampling and laboratory investigations are carried out in order to obtain or maintain a farm in the State of health of "infectious disease" in relation to the herpes virus disease koij. 1. preparation of samples fish samples taken in the following order:-from fish, which a long time kept the temperature range in which the herpes virus may develop koij, i.e. two to three weeks at 15 ° C and 26 ° C; -collect for 24 hours, but not later than 72 hours after the background the management practices, such as networking or transport, which results in the fish body, having the host status, the virus can reactivate. The herpes virus Koij disease surveillance purposes and can be sent for testing to the methods based on PCR, use live or killed and separately sealed in aseptic containers packaged fish or, Alternatively, frozen organs or organ pieces, 80 to 100% preserved in alcohol or viral transport medium (48 hours for processing from the collection). The herpes virus Koij disease surveillance to collect and kidney tissue of gill nets. The herpes virus Koij disease surveillance in order to avoid possible works samples. If necessary, set a couple of samples allowed no more than two fish tissue material. More samples in the mortar with a pestle to mix with the blender or Stomacher and before clarification takes sub-samples DNA extraction. You can do so that for every sampled tissue collected sub-samples that inserts the lizēšan tubes. 1.1. Dna extraction DNA extracted according to standard operating procedures. May use the available DNA extraction kits with which you want the high-quality DNA suitable for use in this chapter described in paragraph 2, the PCR Protocols. Acceptable to the tissue and feed ratio is w/v. 1:9. The tests shall be carried out on 20 to 25 mg of tissue material. 2. the herpes virus Koij disease surveillance with methods based on PCR for herpes virus Koij monitoring using qPCR. If not previously approved in the territory of the positive, positive samples, test results confirmed either arPCR or divsoļ the reverse transcriptase PCR sequencing method of finished products. The resulting clean at least the consensus sequences for the 98% must meet the etalonsekvenc, or if it is not, the samples must be sent to the Latvian National reference laboratory for confirmation. 2.1. the herpes virus koij qPCR detection qPCR is used according to the following description: direct Primer (KHV-86f): 5 '-GACGCCGGAGACCTTGTG-3 ', reverse Primer (KHV-163r): 5 '-CGGGTTCTTATTTTTGTCCTTGT-3 ' and prov (KHV-109p): 5 '-CTTCCTCTGCTCGGCGAGCACG-3-FAM '. Ciklēšan conditions: one cycle with 95 ° C for 15 min, followed by 50 cycles with 94 ° C for 15 seconds and 60 ° C for 60 seconds. qPCR results can vary depending on its execution, i.e. depending on the DNS amplifikator may be necessary to optimize the amplificēšan protocols. Wrong primer hybridization or laboratory contamination can be obtained due to false positive results. In each iteration, the widespread negative template inserted control samples and positive control samples. However, the described option can be used instead of other variants of proven qPCR equivalent effectiveness. 2.2. Normal PCR for herpes virus koij validation to confirm the herpes virus koij presence, uses the following table describes the normal feedback transcriptase PCR divsoļ, after which the resulting material sekven. amplificēt The herpes virus Koij disease approval of N.p.k. Primers and conditions divsoļ feedback transcriptase PCR that mērķvīrus are all cyprinids Herpes (CyHV-1, CyHV-2 and CyHV-3) Primer name sequence of terms Ciklēšan product size 1. CyHVpol-'-CCAGCAACATGTGCGACGG-direct 5 3 ' first raunds1 PCR cycle: 95 ° C, 2 min 40 cycles of 95 ° C, 30 s: 55 ° C, 72 ° C for 30 s, 1 cycle of 72 45 s: ° C, 10 min bp 362 2. CyHVpol-internal direct-CGACGGVGGYATCAGCCC-3 ' 5 ' second raunds1 cycle of PCR: 95 ° C, 2 min 40 cycles of 95 ° C, 30 s: 55 ° C, 72 ° C for 30 s, 1 cycle of 72 45 s: ° C, 10 min from 339 bp 3. CyHVpol-internal 5 '-GAGTTGGCGCAYACYTTCATC-reversible 3 ' PCR results can vary depending on its execution, i.e. depending on the DNS amplifikator may be necessary to optimize the amplificēšan protocols. In addition, the wrong primer hybridization or laboratory contamination can be obtained due to false positive results. In each iteration, the widespread negative template inserted control samples and positive control samples. The variant described in the site may also use other PCR variants with proven effectiveness equivalent. Sequencing can be performed in the laboratory or in specialised in outsourcing sequencing company. The results of sequencing analyzes sequences compared with some of the herpes virus koij etalonsekvenc (Gen Bank access numbers AP008984, DQ657948 and DQ177346). The resulting clean at least the consensus sequences for the 98% must meet the following etalonsekvenc. Vi. Sampling procedures for infectious salmon anaemia, or suspected of being infected with the exclusion of infectious salmon anaemia virus 1. Fish sample preparation Laboratory examinations for the presence of infectious salmon anaemia, if possible, samples of the fish does not copy. However, it is acceptable to set a 2 to 5 fish infectious salmon anaemia surveillance needs. Of all the fish taken from the sample, collects samples for reverse transcriptase polymerase chain reaction (RT-PCR) analysis. From the fish using a sterile instrument removes a piece of vidusnier and place it in a microfuge tube that contained RNA curing solution (1 ml), which the utility has been proven. Tissues in one tube with solution can be collected from up to five fish, and they form one of the sample letters. One sample tissue weight must be 0.5 g. If the fish is too small, the sample weight for the order may pick up the kidney named, heart, spleen, liver, or vārtniek the blind intestine pieces to weight the outcome would be 0.5 g. Tissues for histological examination only of the recent fish kill in a normal build, which is observed for infectious salmon anemia for clinical signs or post-mortem examination results. View all external or internal damage to the samples and from individual fish in all cases with the help of a scalpel take vidusnier, heart, liver, pancreas, bowel, and spleen samples of gill nets, which inserts the 8-10% by volume of formalin in physiological buffer. To Audi saved enough, and the tissue's fixative for must be at least 20:1. Immunochemical analysis (IHC) with vidusnier and heart samples. Of all the sampling of fish tissues for virological examination given in cell culture. With a sterile instrument of fish having a liver, galvasnier, or vidusnier, of the heart and spleen, and place them in a plastic tubes containing 9 ml transport medium in flasks. Tissues from up to five fish may be collected in one tube with a solution, and they form one of the sample letters. One sample tissue weight 1.0 ± 0.5 g be. 2. transmission of samples of fish If during transport can be observed in this chapter, the third indent of paragraph 2, the following temperature requirements, can be sent to the laboratory of whole fish. Whole fish wrapped in absorbent paper and carrying plastic bags, in a cool place, as described in that indent. You can also send live fish, but then transport to monitor fish disease specialist for the Latvian National reference laboratory, and to take into account the additional disinfection and biosecurity problems occurring in the transportation of live fish. Virological examination or RT-PCR analysis of blood samples and provided tubes with fish tissue placed in insulated containers (such as polystyrene boxes with thick walls) together with sufficient ice or aukstumblok, which way to the laboratory provides the chilling of the samples. Samples should not be frozen, but the shipping box it up, should still be ice or one or more of the aukstumblok of which partially or completely frozen. Exceptional circumstances RT-PCR analysis, as well as virological samples under investigation may be quickly frozen and transported to the laboratory at-20 ° C or lower temperature. For RT-PCR analysis of tissues, stored in RNAlater is removed, the RNA depending on the storage temperature of the sample is extracted at this time: 37 ° C stored samples: one day, 25 ° C stored samples: one week, 4 ° C stored samples: one month,-20 ° C stored samples: no date. If fish tissues for histological's fixative must be transported in its investigation, they must send a sealed tubes shock-resistant containers. These samples do not freeze. Cell culture virological investigation started not later than 48 hours after harvesting. In exceptional cases, if the material is protected by transport medium and if possible during transport to comply with the requirements for temperature, virological investigations can start no later than 72 hours after the collection of the material. 3. supplementary diagnostic material in the collection, provided that the diagnostic laboratory, without permits referred to in paragraph 1 to collect and prepare for additional investigation may yet other fish tissues. VII. Laboratory diagnostic methods for the diagnosis of disease or suspicion off of infected with infectious salmon anaemia virus 1. investigation of samples with RT-PCR infectious salmon anaemia virus screening diagnostic method is used in RT-qPCR. Whereas, depending on the circumstances of the RT-qPCR performance results may vary, to prevent any doubt should include sufficient positive and negative controls, and Amplicon. 1.1. The total RNA extraction of RNA carries out all transactions with the gloves on the ice. Total RNA is extracted with phenol-chloroform method or according to the manufacturer's instructions with RNA affinity Rotary tube. Purified RNA repeatedly suspended in distilled from the free water from (i.e. 0.1% dietilpirokarbonāt treated with water). The extracted RNA concentration and purity is evaluated by measuring the optical density at 260 nm and at 280 nm can also use internal control samples containing mērķsegment is genome of the virus, as referred to in point 1.3 of this chapter. 1.2. RT-PCR infectious salmon anaemia virus detection of the infectious salmon anaemia virus genome amplificēšan can use a number of RT-PCR methods. You can make a divsoļ RT-PCR in which the RT and PCR reaction steps executed in two separate tubes. However, you can also make a viensoļ reaction, in which both the reaction runs in one test tube. If possible, use the viensoļ method because the contents are not to be moved, so a single test tube reduces the risk of cross-contamination, Furthermore, considered as sensitive as the divsoļ method. Use this paragraph described primers and primers tested, namely ILA1 and ILA2, a pair of which the mērķsegment is 8. segment and designated as suitable for infectious salmon anaemia virus detection of outbreaks and virus carriers in the body. ILA2 reversible primer do not meet North American isolates, and in such cases, use an alternative set of primers. Direct Primer (ILA1): 5 '-GGCTATCTACCATGAACGAATC-3 ', reverse Primer (ILA2): 5 '-GCCAAGTGTAAGTAGCACTCC-3 '. Ciklēšan conditions: one cycle with a 50 ° C for 30 min, one loop with 94 ° C 15 min, 40 cycles with 94 ° C, 55 ° C for 30 seconds 30 seconds 60 seconds 72 ° C; one cycle with 72 ° C for 5 min. size of the product obtained 155 bp. PCR results can vary depending on its execution, i.e. depending on the DNS amplifikator may be necessary to optimize the amplificēšan protocols. Wrong primer hybridization or laboratory contamination can be obtained due to false positive results. In each iteration, the widespread negative template inserted control samples and positive control samples. However, the described option you can use the other version of the RT-PCR with the proven effectiveness of equivalent. 1.3. RT-qPCR infectious salmon anaemia virus detection By RT-qPCR can achieve greater specificity and, supposedly, also sensitivity. With this method the test can run faster because there is no need for gel electrophoresis step, and it reduces the risk of cross-contamination because of viral genomic RNA quantity can be estimated by the sample tube. RT-qPCR assay has the disadvantage that the products amplificēto are often not possible sekvenē. However, if there is doubt as to the specificity of the product, the amplificēt result validation to perform another infectious salmon anaemia virus specific test. Use the test described in this paragraph, which is 8. mērķsegment segment. This test covers the European Union, the European Free Trade Association and the North American isolates. If possible, use the viensoļ method, because one test tube reduces the risk of cross-contamination. Direct Primer: 5 '-CTACACAGCAGGATGCAGATG-3 ', reversible Primer: 5 '-CAGGATGCCGGAAGTCG-3 ' and 5 '-prov: FAM-CATCGTCGCTGCAGTTC-MGBNFQ-3 '. In each iteration, the widespread negative template inserted control samples and positive control samples. Ciklēšan conditions: one cycle with a 50 ° C for 30 min, one cycle with 95 ° C for 15 min, 40 cycles with 94 ° C, 60 ° C for 15 seconds to 60 seconds; If necessary, adjusted. The variant described in the site may also use other RT-PCR or RT-qPCR variants with proven equivalent effectiveness. 1.4. Amplificēt direct sequencing of PCR products of primer (ILAs6-3F): 5 '-ATGAGGGAGGTAGCATTGC-3 '; reverse Primer (ILAs6-2R): 5 '-CATGCTTTCCAACCTGCTAGG-3 '. In each iteration, the widespread negative template inserted control samples and positive control samples. Ciklēšan conditions (viensoļ RT-PCR): one cycle with a 50 ° C for 30 min, one loop with 94 ° C 15 min, 40 cycles with 94 ° C, 55 ° C for 30 seconds 30 seconds 60 seconds 72 ° C, one cycle with 72 ° C for 5 min; If necessary, adjusted. The variant described in the site may also use other RT-PCR or RT-qPCR variants with proven equivalent effectiveness. Alternatively, the sequencing of the segment 6, HPR, you can use the following method: direct primers: 5 '-GAC-CAG-AC-AGC-TT-GG-AAC-AC-GA-3 ', reversible Primer: 5 '-GAT-GG-GG-att-CTA-CC-CT-GAC-TTG-TA-3 '. Product size: 304 nt, if HPR0. You can also use RT-PCR tests with the same sensitivity and specificity as to the tests described in this paragraph. Before the RT-PCR sequencing of amplificēt cleanliness of the product tested by gel electrophoresis. If you get only one pure fragment, it is cleaned directly after PCR reaction. If there are multiple amplificēt in fragments, gel electrophoresis of the purified fragment of interest. The PCR fragments from agarose gel or solution of purified PCR fragments in accordance with the manufacturer's instructions using Affinity Rotary tube. Sequencing with the amplification primers help make sequencing specialize in outsourcing firms. The results of sequencing analyzes the search tool blast, and the sequences compared with other known sequences in Biotehnisk the U.S. National Information Center (NCB) nucleotide database. Sequencing to remove any doubt as to the amplificēt of the RT-PCR product specificity. 2. the infectious salmon anaemia virus isolation on cell cultures 2.1. sample preparation tissues can be stored in-80 ° c. Prior to the tissues freeze and thaws only once. For the purposes of supervision and control investigations shall be carried out as soon as possible. Each sample (tissue kopoto transport solutions) completely homogenised using validated Homogenizer, 0 to 6 ° C for 15 minutes in a centrifuge (2000 to 4000 x revs/minute), and the supernatant (0.45 μm) after filtration are incubated with an equal volume of a suitably diluted against serotypes of IPNV local izstrādājušo a mixture of Antisera. The titre of the antiserum for the 50% of the plātnīš neutralization test must be at least 1:2000. Mix one hour incubated at 15 ° c. The following retrieves the inoculum. All handling of infectious inoculum pankreātisk necrosis virus Antisera (virus in some parts of Europe occurs in 50% of fish samples) aims to prevent infectious pankreātisk necrosis virus-related CPE developing in inoculated cell cultures. Such treatment can be taken to reduce the duration of the virological examinations as well as the number of cases that should be considered that the CPE potentially indicative of infectious salmon anaemia virus. If the sample is from the production units, which are considered free of infectious pankreātisk necrosis, inocula with infectious pankreātisk necrosis virus Antisera can not be processed. 2.2. cell culture inoculation of primary infectious salmon anaemia virus isolation is used for Atlantic salmon in the kidney (ASK) cells. Given the variability of the strain and the fact that different strains in different reproductive cell lines differ, you can also use other cell lines that have been sufficiently productive and sensitive salmon anaemia virus isolation. If one uses the low level passage considered that so far the known virus isolate isolation and growth of cells occurs in the ASK. ASK the cells can be observed in the increased CPE than other susceptible cell lines, such as SHKI-1 (salmon galvasnier cell-1). ASK (or earlier 65. pārsējum) cells grown in medium plate of daudziedobj L-15 containing 10% fetal bovine serum, 200 mM L-glutamine and 2% by volume of 50 mM 2-mercaptoethanol in 0.08% Vol. With the antisera to handle organ suspension is inoculated, actively growing new cell cultures, looking to the final dilution of tissue material to culture medium to be for each organ 1:1000. well with 2 ml of culture medium 40 μl of inoculum suspension type. To minimise the risk of cross-contamination of samples from different locations using a separate nursery ground plate with 12 or 24 wells. One plate left without inoculum and used as the negative control. For the positive control used for infectious salmon anaemia virus standartizolāt the individual plate inoculated following. First well inoculated a hundred μl izejpreparāt ISAV (minimum titre 107, tissue culture infective dose 50% with the end point (TCID50 ml-1)) and mix well. Determine the volume of this material from the first wells in the second to move the resulting dilution would be for 1:10, and mix well. Repeat this procedure to tenfold dilution for six wells. Infectious salmon anaemia virus izejpreparāt-80 ° C can be kept for at least two years, but after thawing it should be used within three days. Be sure to test plates to prevent cross-contamination with positive control material. To avoid this risk, the positive control samples prepared and operated separately from the test plates. Instead, to use the positive in each inoculation sample can be tested every six months ASK cell sensitivity to infectious salmon anaemia virus isolates. Samples not more than 15 days, incubate for 15 ± 2 ° c. Cell culture under a microscope for CPU check twice-from the fifth to the seventh and from 12 to 14 days after inoculation. If a couple has a sample CPE, without delay and in accordance with this section 2.4 shall start virus identification procedures. Up to 14 days if the CPE is observed, do not direct the imūnfluorescenc antibody test (IFAT), a haemadsorption test or RT-PCR. 2.3. transfer of cells cell casts between 13 and 15 days. Accordingly, diluted (1:10) culture supernatant enters wells that are fresh, actively growing cells and 14 ± 2 ° C incubate for a maximum of 18 days. Cell culture under a microscope for CPU check twice-from the fifth to the seventh and from 14 to 18 days after inoculation. If a couple has a sample CPE, immediately in accordance with section 2.4 of this chapter starts virus identification procedures. If by day 14 to 18 CPE is observed, take the haemadsorption test or RT-PCR test. If cytotoxicity is observed in the first seven days of incubation, cells, dressing in period and incubated for 14 to 18 days, dressing them again and then incubated for a further 14 to 18 days. If cytotoxicity is observed after seven days, the cells in the dressing once and from the first inoculation incubated for 28 to 36 days altogether. If the primary culture experiencing bacterial contamination, prepare the tests again, using the-80 ° C stored tissue homogenate is centrifuged at. Prior to inoculation the tissue homogenate is centrifuged at 0 to 6 ° C for 15 to 30 minutes in a centrifuge for apgriziem 4000 ×/minute, and the supernatant shall be filtered (0.22 μm). If bacterial contamination occurring during the connection of cells, filter the supernatant (0.22 μm), inoculated just pārsēt cells and incubated for a further 14 to 18 days. 2.4. Virus identification tests if any one stage observe CPE or if a haemadsorption test is positive identification of viruses. Infectious salmon anaemia virus identification is the preferred method RT-PCR, carried out in accordance with point 1 of this chapter and imūnfluorescenc (IFA) method under this section 2.6. If it is considered that the possible presence of other viruses, the virus identification of additional tests. If these tests the virus a week is not definitively identified, immediate identification of supernatant shall forward to: (a)) of the World Organisation for animal health (OIE) reference laboratory work or b) to the Latvian National reference laboratory and other Member States of the European Union reference laboratory. 2.5. Haemadsorption whereas infectious salmon anaemia virus replication in cell cultures is not always cause the CPU, then each well under this paragraph shall take the RT-PCR test or a haemadsorption test or in accordance with section 2.6 of this chapter-IF. Of all the wells, including the positive and negative control wells, with cell culture medium shall be removed and placed in labelled sterile tubes. Into each well five hundred μl of rabbit or horse washed erythrocytes in 0.2% vol or tumbled rainbow trout or Atlantic salmon red blood cells suspension in 0.05% vol and incubated at room temperature for 45 minutes. Then erythrocytes suspension drained and rinsed twice in each Chamber with medium L-15. Each cavity checked under a microscope. If the ASK cell surface is a combination of red, is a possible infection with an orthomyxovirus. If a haemadsorption test is positive, without delay and in accordance with this section 2.4 shall be virus identification test. 2.6. Imūnfluorescenc (IF) ASK (or earlier 65. pārsējum) daudziedobj plates grown in L-15 medium containing 10% fetal bovine serum, 200 mM L-glutamine and 2% by volume of 50 mM 2-mercaptoethanol in 0.08% Vol, and used when konfluenc is exceeded 50%. You can also use other cell lines or feed, which the utility has been proven. Two wells each added 225 µl of virus cultures are likely to be contaminated the supernatant, 225 μl mix well and pour into two more wells, gaining two more of the dilution 1:5. Wells do not enter, and inoculum used for control samples. Samples from each fish farms, as well as virus control uses a separate plate. Virus control used for infectious salmon anaemia virus standartizolāt. Plates are incubated at 14 ± 2 ° C and its microscopic scrutiny not later than 7 days. If in the early stages of the CPE is observed, as well as when the 7 days of CPE is observed, the next step is the fixation is made. Wells with phosphate buffer solution (PBS) and the room temperature for 20 minutes with incubation technique is recorded with 80% acetone. The plate is dried with air flow and shade or immediately before a painting no longer than 24 hours stored in the 0 to 6 ° c. Replicated trenches stained with mixture of infectious salmon anaemia virus monoclonal antibody (MAb) and 1OC9F5 or with another 3H6F8 MAb efficacy and specificity of which is proven, then diluted in PBS and incubate 30 minutes at 37 ± 4 ° C. Then the plates are exempt from monoclonal antibodies and three times with 0.05% Tween 20 in PBS. Each well is filled with diluted PBS mice antibodies IgG and fluorescīn isothiocyanate (FITC) conjugate and incubate 30 minutes at 37 ± 4 ° C. Monoclonal antibody and FITC conjugate dilution of the various lots in each laboratory optimizes. Plates from antibodies and released three times 0.05% Tween 20 in PBS. Immediately after the inversion test wells in the microscope fluorescence microscopy, adapted and equipped with FITC filter applied. If fluorescent cells are observed, it is considered that the test is positive. Check is only valid if the results are positive control samples are positive, but negative-negative. 3. other tissue examination this chapter 2.6. the techniques referred to in point can also be used in other tissues such as liver, spleen and heart, if one manages to transfer the slides enough endothelial cell, leucocyte or lymphocytes. All tissues use the same painting techniques, while some tissues should not be painted with propidium iodide, but both types of cells in imprint by the phase kontrastmikroskop. 4. Histology Of paraffin having invested in cuts 5 mm thick cuts and color haematoxylin and eosin. Clinically ill Atlantic salmon has been evolving organism histological changes, but among them may be the following: (a) the number of red cells in the sinuses and the central venous capillaries of the gills, plātnīš which also can be formed clot of Red; (b) next to the large blood vessels of the liver occurs vairākperēkļ or blurring, Petechial hepatocyte necrosis, or both processes; perēkļveid mass of erythrocytes in the enhanced liver sinusoīdo; (c) red blood cells accumulation intestinal lamina of blood vessels and tentative propriu bleeding propriu lamina; (d) the accumulation of red blood cells results in increased splenic stromal; (e) the interstitial bleeding-from mild to extensive diffuse vairākperēkļ, with tubular necrosis, bleeding red blood cells accumulation kidney kamoliņo; (f) the spleen and eritrofagocitoz secondary bleeding, liver and kidneys. Immunohistochemistry (IHC) 5 in Formalin Fixed tissue parafinēt cuts using Polyclonal antibodies against ISAV nukleoproteīn. Investigate the vidusnier and heart (transition space, which includes three Chamber and valves). Pathological signs of suspected cases would test positive for using IHC. Histological cuts prepared by standard methods. 5.1. preparation of the tissue cut tissue under standartprotokol at least one day recorded in 10% neutral formalin in PBS, dewatered with gradually increasing strength ethyl alcohol clarified with ksilēn and invests in paraffin. Patomorfoloģij and IHC needs about 5 μm thick cuts (IHC needs-to with with poly-L-lysine-skin) 20 minutes heat in 56 ° C to 58 ° C (max. 60 ° C), with the help of the atvask ksilēn, with gradually decreasing strength of rehidrat ethyl alcohol, as well as under point 2 color haematoxylin and eosin. 5.2. procedure for IHC Staining needs any incubation is carried out at room temperature to svārstplatform, unless otherwise provided in this decision: (a) Antigen recovery ensure cuts 2 × 6 minutes boiling 0.1 M citrate buffer pH 6.0, followed by 20 min blocking with 5% non-fat dry matter of milk and 2% goat serum 50 mM TBS (TBS; TRIS/HCl, 150 mM, 50 mM NaCl pH 7.6); (b) the incision to incubate overnight with primary antibody (rabbit antibody against monospecifisk infectious salmon anaemia virus nukleoproteīn) diluted at 1% milk solids-non-fat in TBS, then triple-rinsed with containing 0.1% Tween 20 TBS; (c) for the detection of antibodies related to incubate 60 minutes cut rabbit IgG antibody of alkaline phosphatase conjugate. After the final rinse adds fast Red (mg ml-1 l) and naphthol AS-MX phosphate (0.2 mg ml-1) 0.1 M by 1 mM levamizol TBS (pH 8.2) and 20 minutes to develop. Then cut tap water to rinse, contrast color with Harris hematoxylin and covered with a water-based pārklājbarotn. Each test shall include the preparation of samples-in respect of infectious salmon anaemia virus in both positive and negative tissue cut. 5.3. interpretation of the results the IHC IHC test results are interpreted, as described below in this point a) and (b)): (a)) kontrolgriezum on positive feels when kontrolgriezum clearly visible that the endokard vascular endothelial cell cytoplasm and nucleus are colored red (reddish). Cut the test sample is considered positive only if such a clearly visible red kernel coloring establishes endothelial cells; (b)) kontrolgriezum on negative believes if they are not observed any significant color reaction. As for the nukleoproteīn virus, orthomyxovirus replication stage are specific locale in the kernel, but often at a more pronounced is a cytoplasm. The cytoplasmic staining and other forms of marking that is not localized in the nucleus, is regarded as a non-specific or not decisive. Positive case of coloring reaction more pronounced usually show heart and renal endothelial cells. Very broad hemorāģisko lesion of endothelial colouring reactions can be expressed little or no observable probably infected in an endothelial cell lysis. IIX. Laboratory diagnostic methods for Marteilia refringens, infection for approval 1. sampling procedure for the probability to find the infected animals would be greater, taking samples, the preference is for bivalve molluscs, which parted or just died. Sampled oysters or mussels plastic bag whose label contains information about oyster or Mussel the origin and characteristics of 4 ° C or on ice chilled there for no longer than 24 hours, if the sample contains parted bivalve molluscs, and no longer than 72 hours if it does not pavērušo the shellfish. Parted or just dead molluscs kept separate from other bivalve molluscs. Marteilia refringens histological diagnosis uses 3 to 5 mm thick tissue, which includes gills and the heart tissue. Some tests, including fingerprints and polymerase chain reaction (PCR) is used in digestive gland tissues. 2. Microscopic techniques 2.1. Cytology (cytology of fingerprints) When the digestive gland tissue dried on absorbent paper to slide left multiple footprints. Slide preparations with a dry air flow, fixed or absolute methanol alcohol and flavor, in accordance with the manufacturer's instructions using one of the commercially available preparations of blood staining reagents kits, such as the Diff-Quik ®/Hemacolor ®. When to wash with tap water and drained, with suitable for synthetic rubber puts on stage help. The slides are first observed magnification x 200 and then immersed in oil x1000 magnification. The result is positive if the observed cell that size from 30 to 40 μm. The cytoplasm is stained, bazofil turn-eozinofil the core of the leucocytes. You can monitor the pale roving around large, heavily stained (reflective) and more granular cells, the cell in the cell. This technique is used for any species of parasites. 2.2. Histology tissue cuts, which include Gill, digestive gland, and gonads of the mantle, at least 24 hours recorded Davidson's fixative, then normally treated with paraffin and stained for histological examination, such as with hematoxylin and eosin. Observations are made increasingly higher magnification up to 1000 ×. The result is positive if the observed cell that size from 4 to 40 μm. The early stages have been the multicore cell and cells that form is to extend from the spherical. It is found mainly in the oesophagus and stomach, sometimes mouth tentacles epithelium. Sporulācij binds to cell division takes place inside the cells and the digestive gland and kanāliņo wires. Sporulācij process in a reflective granules, but early stages they are not observed. Late stages of infection of certain sporangij to observe the digestive tract lumen. The cytoplasm is stained, bazofil turn-eozinofil the core of the leucocytes. Pellet color may vary from dark orange to dark red. This technique is used for any species of parasites. 3. Molecular techniques 3.1. Dna extraction DNA extracted according to standard operating procedures. May use the available DNA extraction kits with which you want the high-quality DNA suitable for use i. 3.2. PCR Protocols described in paragraph 1. 3.2. the polymerase chain reaction (PCR) Has developed and published a number of PCR Protocols. They should be used in PCR primers that have internal transcribed mērķrajon speiser (ITS1) in the region, because they can only be amplificē m. refringens. 50 μl PCR implemented. The PCR mixture containing buffer (500 mM KCl, 100 mM TRIS/HCl [pH 9.0 ° C 25] and 1% Triton ® X-100), 2.5 mM MgCl2, 0.2 mM, 1 mm dntps mixture of direct and reverse primer, 0.02 units Taq DNA polymerase-1 ml, and 10 to 100 ng of DNA extracted. When the DNA is denatured five minutes 94 ° C, the following 30 cycles of: denaturation with 94 ° C, 1 min 55 ° C the hybridisation with 1 min, and-one minute on each of the over-elongācij of the kilobāz with 72 ° c. Take the last step of the elongācij-72 ° C for 10 minutes. M. refringens made PCR with primers for the detection of mērķrajon is the ITS1 (5 '-CCG-ACG-CAC-TTC-TTC-Act-CC-3 ' and 5 '-GCG-CTC-AG-TTC-GAC-AG-CG-3 '). Positive controls are from heavily infected host genomic DNA was obtained or plasmid DNA, which is mērķrajon. Negative control are included in the composition of uninfected hosts obtained the DNA and genomic PCR reagents besides the target DNA. A positive result is positive PCR amplification of the expected size (bp 412), all negative control results are negative and positive results of all control samples – positive. 3.3. the In-situ hybridization (ISH) Developed and published, there are several ISH protocols. In the process, which uses mērķrajon rRNA gene complex is the small subunit, as it is histologically validated. Tissue cuts, which include gills and digestive gland, recorded at least 24 hours and then Davidson, 's fixative normally treated with paraffin for histological examination. Cut 5 mm thick cuts, which placed on slides with aminoalkilsilān coating and then heat on 40 ° C hot oven. Atvask cuts, dipping ksilēn for 10 minutes. This step is repeated once and then dispose of the solvent, cuts twice for 10 minutes immersion in alcohol absolute will float. After the cuts, the immersion dehidrat a growing strength in ethyl alcohol. Cut to 37 ° C for 30 minutes with proteināz K (100 mg ml-1) TE buffer (TRIS [50 mM], EDTA [10 mM]). With the dewatered, the growing strength of the ethanol immersion, then air dry. Incubate with 100 μl cuts hybridization buffer (4 × SSC [physiological solution of citrate] 50% formamide, 1 x Denhardt solution 250 mg ml-1, yeast 4, sulphate 10% dekstrān) containing 10 ng (1 μl PCR reagent, prepared as described in this section 3.2, using the primers CCG-GTG-CC-GG-AT-TC-CG and TTC-GGG-TGG-TC-TGA-AAG-GC) prov, marked with digoksigenīn. Cuts covered with in situ plastic coverslip and for five minutes on a 95 ° C karstumblok. Before with the 42 ° C overnight left the humid Chamber, hybridised them on ice for one minute as. Cuts twice five minutes at room temperature wash 2 x SSC, and once 10 minutes 42 ° C rinse 0.4 × SSC. Detection steps carried out in accordance with the manufacturer's instructions. Then rinse them with sterile distilled water (dH2). Cut color neutralize with Bismarck Brown Yellow, flushed with dH2 and using water-based pārklājbarotn, to the coverslip. Positive and negative controls, respectively, is cut from a known infected and uninfected hosts. All negative control samples were negative and positive for all positive control samples, the positive results suggest violet black-stained m. refringens, known for the target cell. 3.4. Sequencing sequencing is conducted as one of the definitive diagnosis of affirmative steps. Mērķrajon is a small subunit and rDN ITS1. IX. Laboratory diagnostic methods for Marteilia refringens surveillance monitoring programmes and approve marteiliosis (Marteilia refringens) in the presence or suspicion of this disease off, use the diagnostic methods and procedures in question, as shown in the following table are guidelines. Guidelines on the use of diagnostic methods in monitoring programmes and marteiliosis (Marteilia refringens) for approval or exclusion N.p.k. Targeted monitoring method in diagnosis in the Positive Presumptive diagnosis 1. Digestive gland prints X X X or 2. Histopathology X X or 3. In situ hybridization and 4 X. PCR X X X and 5. Sequencing X X. Laboratory diagnostic method Bonamia ostreae diagnosis of infection. 1. the sampling process To the probability to find infected animals would be greater, taking samples, the preference is for bivalve molluscs, which parted or just died. Sampled oysters in plastic bag, which the label contains information on the origin and characteristics of oysters, 4 ° C or on ice chilled there for no longer than 24 hours, if the sample contains parted bivalve molluscs, and no longer than 72 hours if it does not pavērušo the shellfish. Parted or just dead molluscs kept separate from other bivalve molluscs. Histological diagnosis of bonamiosis uses 3 to 5 mm thick tissue, cut from the gills and heart tissue. Some tests, including fingerprints and polymerase chain reaction (PCR), use the digestive gland tissues. 2. Microscopic techniques 2.1. Cytology (cytology of fingerprints) when the gills or heart tissue dried on absorbent paper to slide left multiple footprints. Slide preparations with a dry air flow, fixed or absolute methanol alcohol and flavor, in accordance with the manufacturer's instructions using one of the commercially available preparations of blood staining reagents kits, more specific, such as the Diff-Quik ®/Hemacolor ®. When to wash with tap water and drained, with suitable for synthetic rubber puts on stage help. The slides are first observed magnification x 200 and then immersed in oil x1000 magnification. A positive result will be small (2 to 5 μm wide) spherical or ovoid body presence in hemocytes within. However, the presence of the parasite is also possible outside the cells. These organisms occur in the cytoplasm and nucleus of the white bazofil-eozinofil-white (the color may vary depending on the painting features) and, as they escape on a slide, on the prints they may look wider than histological examination. Can be observed in the multi-core cell. This technique is used for any species of parasites. 2.2. Histology tissue cuts, which include gills and digestive gland, at least 24 hours recorded Davidson's fixative, then normally treated with paraffin and stained for histological examination, such as with hematoxylin and eosin. Observations are made increasingly higher magnification up to 1000 ×. Positive result is the presence of the parasite in the form of very small, 2 to 5 μm wide cells that occur in hemocytes within or separate Gill, gut and mantle epithelial saistaudo or caverns and is often associated with a strong inflammatory reaction. To turn off any doubts and set a positive diagnosis requires the parasite would be seen in hemocīt. This technique is used for any species of parasites. 3. Molecular techniques 3.1. Dna extraction DNA extracted according to standard operating procedures. May use the available DNA extraction kits with which you want the high-quality DNA for use in PCR Protocols described below. 3.2. the polymerase chain reaction (PCR) Developed and published, there are several PCR Protocol. You can use two PCR Protocols which mērķrajon is a small subdivision of the rDN: (a) the first is the conventional PCR that amplific several Haplosporidi representatives, also the Bonamia spp. Primers, known as Bo, and Bo, respectively 5 '-CAT-TT-AT-GG-CGG-GCC-GC-3 ' and 5 '-CTG-ATC-GTC-TTC-GAT-CCC-CC-3 ', and the amplification product is 300 bp. The PCR mixture containing buffer (500 mM KCl, 100 mM TRIS/HCl [pH 9 25 ° C] and 1% Triton ® X-100), 2.5 mM MgCl2, 0.2 mM, 1 mm dntps mixture of direct and reverse primer, 0.02 units Taq DNA polymerase-1 μl, and 0.2 ng ml-1 DNA templates in 50 ml total volume. First samples of DNA amplifikator with 94 ° C for 5 min, then denatured subjected to 30 cycles (94 ° C, 55 ° C for one min min, 72 ° C per one), then 10 minutes at 72 ° C making the final extension. Positive controls are from heavily infected host genomic DNA was obtained or plasmid DNA, which is mērķrajon. Negative control consists of uninfected hosts obtained the DNA and genomic PCR reagents besides the target DNA. A positive result is positive PCR amplification of the expected size (say, 300 bp), all negative control samples were negative and all positive control samples – positive; (b) the second PCR Protocol PCR SYBR ® Green real-time. It is possible to determine the specific b. ostreae (described below) and may be combined with SYBR Green real-time PCR ®, which makes it possible to determine the specific b. exitios (Ramil 2013 the et al.). BOSTR-F primers (5 '-TTACGTCCCTGCCCTTTGT-3 ') and BOSTR-R (5 '-TCGCGGTTGAATTTTATCG-3 ') amplific the 208 bp product. SYBR ® Green PCR mixture containing Master Mix (1 x), 0.3 μM direct and reverse primer and 200 ng of DNA extracted. Samples are first with 95 ° C for 10 minutes of real-time detection system has been denatured, then met with them 35 cycles (with 95 ° C for 30 seconds, 55 ° C 45 ° C and ssekund with the one 72 min). With the increase in temperature in 0.5 ° C of step/s analyzes the melting curve, starting 55 ° C and 95 ° C temperature finally and at each the change of temperature sensing fluorescence. Positive controls are from heavily infected host genomic DNA was obtained or plasmid DNA, which is mērķrajon. Negative control consists of uninfected hosts obtained the DNA and genomic PCR reagents besides the target DNA. All negative control samples were negative and all positive control samples were positive, a positive result is positive PCR amplification with a unique melting temperature maximum (with conditions published by 2013 the et al.-Ramil 78.25 ± 0.25 ° C). 3.3. the In-situ hybridization (ISH) Has developed and published a number of ISH protocols. In the process, which uses mērķrajon rRNA gene complex is the small subunit. There is evidence that cross react with some other Haplosporidi belong to the family of organisms. Tissue cuts, which include gills and digestive gland, recorded at least 24 hours and then Davidson, 's fixative normally treated with paraffin for histological examination. Cut 5 mm thick cuts, which placed on slides with aminoalkilsilān coating and then heat on 40 ° C hot oven. Atvask cuts, dipping ksilēn for 10 minutes. This step is repeated once and then dispose of the solvent, cuts twice for 10 minutes immersion in alcohol absolute will float. Then rehidrat, cuts them soaking in the waning strength ethyl alcohol. At 37 ° C the cut 30 minutes with proteināz K (100 mg ml-1) TE buffer (TRIS [50 mM], EDTA [10 mM]). With the dewatered, the growing strength of the ethanol immersion, then air dry. Incubate with 100 μl cuts hybridization buffer (4 × SSC [physiological solution of citrate] 50% formamide, 1 x Denhardt solution 250 mg ml-1, yeast 4, sulphate 10% dekstrān) containing 20 ng (2 μl PCR reaction, prepared as described in this section 3.2, using the primers Bo, and Bo) prov, marked with digoksigenīn. Cuts covered with in-situ type plastic coverslip, and for five minutes on a 95 ° C karstumblok. Before with the 42 ° C overnight left the humid Chamber, hybridised them on ice for one minute as. Cuts twice five minutes at room temperature wash 2 x SSC, and once 10 minutes 42 ° C rinse 0.4 × SSC. Detection steps executed in accordance with the manufacturer's instructions. Then rinse them with sterile distilled water (dH2). Cut color neutralize with Bismarck Brown Yellow, flushed with dH2 and using water-based pārklājbarotn, to the coverslip. Positive and negative controls, respectively, is cut from a known infected and uninfected hosts. All negative control samples were negative and positive are positive, a positive result is observed in hemocytes within the colored parasites. 3.4. Sequencing sequencing is conducted as one of the definitive diagnosis of affirmative steps. Mērķrajon is a small subunit and rDN ITS1. XI. Laboratory diagnostic method Bonamia ostreae infection surveillance and disease diagnosis for approval to implement the monitoring program and approved the presence of Bonamia ostreae or off the suspected contamination with the use of appropriate diagnostic methods and procedures laid down in the guidelines below. Guidelines on the use of diagnostic methods in monitoring programmes and Bonamia ostreae or suspected of infection removal for infection with Bonamia ostreae N.p.k. Targeted monitoring method in diagnosis in the Positive Presumptive diagnosis 1. Heart or Gill tissue prints X X X or 2. Histopathology X X or 3. In situ hybridization and 4 X. PCR X X X and 5. X XI. Sequencing laboratory diagnostic method for cancer baltplankum disease for approval 1. This section describes the methods and procedures are adapted from ISO 17025 accredited test used in diseases of crustaceans specialized reference laboratories of the European Union. You can use an alternative approach that uses equivalent conditions or sets that are produced by other manufacturers, but that offer the tests described in this part the equivalent sensitivity and specificity. In all cases, polymerase chain reaction, the product amplificēt sekven to certify that it is identical to the baltplankum cancer syndrome virus. 2. sampling procedure for crustaceans in virus-free tissue (vēderkāj and gills) can be stored in ethyl alcohol, RNAlater is removed or fast-80 ° c to freeze. Stages necessary for cancer of the baltplankum disease virus identification from tissue samples are: tissue homogenisation, DNA extraction, the cancer of baltplankum disease virus DNA by PCR specific amplificēšan, amplificēt product visualization to the gel, the DNA purification and sequencing. 3. tissue homogenisation of tissue homogenate is centrifuged at saārdīšan and for the preparation of a suitable buffer uses the FastPrep and saārdītāj of tissue Matrix A Lysing tubes (MP Biomedical). Weigh the tissues, inserts a Lysing tubes, A suitable Matrix buffer (for use with DNA tissue Kit (Qiagen) – G2 and 10 µl Proteinase K) dilute until the m/v. is 1/10 or as specified by the manufacturer, and homogenize for 2 minutes with the Homogenizer FastPrep Homogenized samples 24. incubate at 56 ° c for at least four hours or overnight. Samples processed in two minutes virpuļmikser centrifuge with 9000 rpm and 50 μl of supernatant or the amount equivalent to 5 mg of tissue (extraction Kit optimal tissue weight), add the DNA extraction for sample tube buffer volume, and with the G2 is increased to 200 µl. 4. Dna extraction of total DNA extracted according to the manufacturer's instructions, using the DNA of tissue extraction Kit and Advanced XL Biorob EZ1 (Qiagen). For each batch of samples processed extraction control (Calf thymus DNA) and negative control (G2 buffer). 50 ml to elute DNA. To ensure that extraction ended successfully, with the help of the machine determine the NanoDrop DNA concentration in all samples and control. If the extracted DNA is not immediately necessary, freeze-20 c. Polymerase chain reaction (PCR), which finds the baltplankum cancer disease virus detection method used for WSSV is a reversible transcriptase PCR divsoļ, in which the first and second round of PCR in the rRNA gene amplific 18 in 1447 and 848 bp Amplicon BPA. The first round must prepare the PCR reaction volume of 50 ml, in which the final concentrations of 1 x Buffer GoTaq (Promeg), 5 mm MgCl2, 1 pmol/µl primer 146 F1 WSSV 1 pmol/µl primer WSSV 0.25 mM R1, 146 dNTP Taq polymerase, 1.25 U and 2.5 µl DNA. Reaction with all samples run in duplicate together with a negative control sample extraction, negative PCR control (DNA site added to 2.5 ml H2O) and positive controls. The positive control sample is diluted cancer disease virus of baltplankum plasmid, produced and validated for use in the lab (available from the EURL).
N.p.k. The second round of PCR reaction WSSV prepare just like the first round, but uses the WSSV 146 F2/R2 primer Kit and another positive controls, which ensure that this PCR stage is failed. The sequence of primer 1. F1 ACTACTAACTTCAGCCTATCTAG 2 146 WSSV. 3. TAATGCGGGTGTAATGTTCTTACG 146 WSSV R1 F2 GTAACTGCCCCTTCCATCTCC 4 146 WSSV 146 the WSSV R2 TACGGCAGCTGCTGCACCTTG PCR products is precipitated using a method with sodium acetate, where 10 μl, 70 μl H2O NaAc 250 μl of ethyl alcohol and add 20 μl DNA, processes and virpuļmikser with 13 000 rpm centrifuge for 20 minutes, remove the supernatant and wash the tube with 200 μl absolute alcohol, centrifugation for five minutes with 13 000 rpm. The tube for five minutes at 37 ° c dry. Add 25 mL vials Hi-Di formamide, two minutes 95 ° c and heated to well handle virpuļmikser. The samples according to the manufacturer's instructions with the analyser ABI3130xl sekven avant Genetics. Sequencing results analysed using sequencing software, Sequencher and sequences to sequences using blast run function in the database to the NCBS. Interior Minister Richard Kozlovsk a